TRF41 (PAPD7) (NM_001171806) Human Untagged Clone
CAT#: SC328577
PAPD7 (untagged)-Human PAP associated domain containing 7 (PAPD7) transcript variant 3
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LAK-1; LAK1; POLK; POLS; TRF4; TRF4-1; TRF41; TUTASE5 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001171806, the custom clone sequence may differ by one or more nucleotides
ATGCTTCTTGTAGAATTTTTTGAACTCTATGGGAGAAATTTTAATTACTTGAAAACCGGT ATTAGAATCAAAGAAGGAGGTGCCTATATCGCCAAAGAGGAGATCATGAAAGCCATGACC AGCGGGTACAGACCGTCGATGCTGTGCATTGAGGACCCCCTGCTGCCAGGGAATGACGTT GGCCGGAGCTCCTATGGCGCCATGCAGGTGAAGCAGGTCTTCGATTATGCCTACATAGTG CTCAGCCATGCTGTGTCACCGCTGGCCAGGTCCTATCCAAACAGAGACGCCGAAAGTACT TTAGGAAGAATCATCAAAGTAACTCAGGAGGTGATTGACTACCGGAGGTGGATCAAAGAG AAGTGGGGCAGCAAAGCCCACCCGTCGCCAGGCATGGACAGCAGGATCAAGATCAAAGAG CGAATAGCCACATGCAATGGGGAGCAGACGCAGAACCGAGAGCCCGAGTCTCCCTATGGC CAGCGCTTGACTTTGTCGCTGTCCAGCCCCCAGCTCCTGTCTTCAGGCTCCTCGGCCTCT TCTGTGTCTTCACTTTCTGGGAGTGACGTTGATTCAGACACACCGCCCTGCACAACGCCC AGTGTTTACCAGTTCAGTCTGCAAGCGCCAGCTCCTCTCATGGCCGGCTTACCCACCGCC TTGCCAATGCCCAGTGGCAAACCTCAGCCCACCACTTCCAGAACACTGATCATGACAACC AACAATCAGACCAGGTTTACTATACCTCCACCGACCCTAGGGGTTGCTCCTGTTCCTTGC AGACAAGCTGGTGTAGAAGGAACTGCGTCTTTGAAAGCCGTCCACCACATGTCTTCCCCG GCCATTCCCTCAGCGTCCCCCAACCCGCTCTCGAGCCCTCATCTGTATCATAAGCAGCAC AACGGCATGAAACTGTCCATGAAGGGCTCTCACGGCCACACCCAAGGCGGCGGCTACAGC TCTGTGGGTAGCGGAGGTGTGCGGCCCCCTGTGGGCAACAGGGGACACCACCAGTATAAC CGCACCGGCTGGAGGAGGAAAAAACACACACACACACGGGACAGTCTGCCCGTGAGCCTC AGCAGATAA |
Restriction Sites | Please inquire |
ACCN | NM_001171806 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001171806.1, NP_001165277.1 |
RefSeq Size | 3473 bp |
RefSeq ORF | 1089 bp |
Locus ID | 11044 |
UniProt ID | Q5XG87 |
Protein Pathways | RNA degradation |
Gene Summary | The protein encoded by this gene is a DNA polymerase that is likely involved in DNA repair. In addition, the encoded protein may be required for sister chromatid adhesion. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jan 2010] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229939 | PAPD7 (Myc-DDK-tagged)-Human PAP associated domain containing 7 (PAPD7), transcript variant 3 |
CNY 5420.00 |
|
RC229939L3 | Lenti-ORF clone of PAPD7 (Myc-DDK-tagged)-Human PAP associated domain containing 7 (PAPD7), transcript variant 3 |
CNY 7320.00 |
|
RC229939L4 | Lenti-ORF clone of PAPD7 (mGFP-tagged)-Human PAP associated domain containing 7 (PAPD7), transcript variant 3 |
CNY 7320.00 |
|
RG229939 | PAPD7 (tGFP-tagged) - Human PAP associated domain containing 7 (PAPD7), transcript variant 3 |
CNY 5990.00 |