LRRC34 (NM_001172780) Human Untagged Clone
CAT＃: SC328576
LRRC34 (untagged)-Human leucine rich repeat containing 34 (LRRC34) transcript variant 1
CNY 5800.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001172780, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCGCAGCCGCCGCGGCCAGTGGGTGAGAGGAGCATGGGGAGCTCCCGGGAGGCC GCCCGTGCGCCGGCCAGGTCCCCGGCTTGGGCCTCCACTCAGGCCAGTACTCCGGGCGCG GCCCTGGCGGTCCAGCGCGAATCTCCAGAATCTGGTCTCCAGAAACATTATTCTAATCTG TGTATGGAAAAATCCCAGAAAATTAATCCTTTTATATTGCATATACTCCAAGAAGTGGAT GAAGAAATTAAAAAGGGGCTAGCAGCAGGAATCACATTAAACATTGCTGGTAACAATCGC TTAGTGCCAGTAGAAAGAGTTACAGGTGAAGATTTTTGGATTCTTTCCAAAATTTTAAAG AATTGTCTGTATATTAATGGTTTGGATGTTGGATATAACCTTCTATGTGATGTTGGTGCA TACTATGCTGCGAAACTGCTTCAGAAACAACTTAATCTCATTTACTTAAACCTCATGTTT AATGATATTGGGCCCGAAGGTGGAGAATTGATTGCTAAAGTGCTACATAAGAATCGGACT CTGAAATACCTAAGAATGACTGGAAACAAAATTGAAAATAAAGGTGGAATGTTTTTTGCT GCAATGCTGCAAATTAATTCATCATTAGAGAAATTAGATCTGGGTGACTGTGATCTGGGA ATGCAAAGTGTGATAGCATTTGCTACAGTACTAACTCAAAACCAAGCAATTAAGGCAATA AACCTAAACCGACCTATACTGTACAGTGAACAGGAAGAGTCTACAGTCCATGTAGGCCGC ATGTTGAAAGAAAATCACTGTCTTGTTGCACTACACATGTGTAAGCATGATATAAAAAAC AGTGGTATACAACAGTTATGTGATGCACTGTATCTGAACAGTAGCCTGCGCTACCTTGAT GTCAGCTGCAACAAAATAACTCATGATGGAATGGTGTATTTGGCTGATGTACTGAAAAGC AACACTACCCTGGAAGTAATAGATCTTTCCTTTAACAGAATAGAAAATGCAGGCGCAAAC TATCTCAGTGAAACTCTTACTTCACACAACAGGAGTCTTAAAGCGTTAGTATGGTTTTAT ATTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001172780 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001172780.1, NP_001166251.1 |
| RefSeq Size | 1892 bp |
| RefSeq ORF | 1086 bp |
| Locus ID | 151827 |
| Gene Summary | Highly expressed in stem cells where it may be involved in regulation of pluripotency. In embryonic stem cells (ESCs), important for normal expression of the pluripotency regulators POU5F1/OCT4 and KLF4. Also important for expression of the ectodermal marker gene NES and the endodermal marker gene GATA4. Promotes stem cell proliferation in vitro.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229938 | LRRC34 (Myc-DDK-tagged)-Human leucine rich repeat containing 34 (LRRC34), transcript variant 1 |
CNY 3656.00 |
|
| RC229938L3 | Lenti-ORF clone of LRRC34 (Myc-DDK-tagged)-Human leucine rich repeat containing 34 (LRRC34), transcript variant 1 |
CNY 5890.00 |
|
| RC229938L4 | Lenti-ORF clone of LRRC34 (mGFP-tagged)-Human leucine rich repeat containing 34 (LRRC34), transcript variant 1 |
CNY 5890.00 |
|
| RG229938 | LRRC34 (tGFP-tagged) - Human leucine rich repeat containing 34 (LRRC34), transcript variant 1 |
CNY 4370.00 |
