CX3CR1 (NM_001171172) Human Untagged Clone
CAT#: SC328569
CX3CR1 (untagged)-Human chemokine (C-X3-C motif) receptor 1 (CX3CR1) transcript variant 3
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CCRL1; CMKBRL1; CMKDR1; GPR13; GPRV28; V28 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001171172, the custom clone sequence may differ by one or more nucleotides
ATGGATCAGTTCCCTGAATCAGTGACAGAAAACTTTGAGTACGATGATTTGGCTGAGGCC TGTTATATTGGGGACATCGTGGTCTTTGGGACTGTGTTCCTGTCCATATTCTACTCCGTC ATCTTTGCCATTGGCCTGGTGGGAAATTTGTTGGTAGTGTTTGCCCTCACCAACAGCAAG AAGCCCAAGAGTGTCACCGACATTTACCTCCTGAACCTGGCCTTGTCTGATCTGCTGTTT GTAGCCACTTTGCCCTTCTGGACTCACTATTTGATAAATGAAAAGGGCCTCCACAATGCC ATGTGCAAATTCACTACCGCCTTCTTCTTCATCGGCTTTTTTGGAAGCATATTCTTCATC ACCGTCATCAGCATTGATAGGTACCTGGCCATCGTCCTGGCCGCCAACTCCATGAACAAC CGGACCGTGCAGCATGGCGTCACCATCAGCCTAGGCGTCTGGGCAGCAGCCATTTTGGTG GCAGCACCCCAGTTCATGTTCACAAAGCAGAAAGAAAATGAATGCCTTGGTGACTACCCC GAGGTCCTCCAGGAAATCTGGCCCGTGCTCCGCAATGTGGAAACAAATTTTCTTGGCTTC CTACTCCCCCTGCTCATTATGAGTTATTGCTACTTCAGAATCATCCAGACGCTGTTTTCC TGCAAGAACCACAAGAAAGCCAAAGCCATTAAACTGATCCTTCTGGTGGTCATCGTGTTT TTCCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGACGCTTAAGCTCTATGAC TTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGCTGGCCCTCAGTGTGACTGAGACG GTTGCATTTAGCCATTGTTGCCTGAATCCTCTCATCTATGCATTTGCTGGGGAGAAGTTC AGAAGATACCTTTACCACCTGTATGGGAAATGCCTGGCTGTCCTGTGTGGGCGCTCAGTC CACGTTGATTTCTCCTCATCTGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGC AATTTTACTTACCACACGAGTGATGGAGATGCATTGCTCCTTCTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001171172 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001171172.1, NP_001164643.1 |
RefSeq Size | 3224 bp |
RefSeq ORF | 1068 bp |
Locus ID | 1524 |
UniProt ID | P49238 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
Gene Summary | Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2, 3, and 4 all encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229931 | CX3CR1 (Myc-DDK-tagged)-Human chemokine (C-X3-C motif) receptor 1 (CX3CR1), transcript variant 3 |
CNY 3656.00 |
|
RC229931L3 | Lenti-ORF clone of CX3CR1 (Myc-DDK-tagged)-Human chemokine (C-X3-C motif) receptor 1 (CX3CR1), transcript variant 3 |
CNY 5890.00 |
|
RC229931L4 | Lenti-ORF clone of CX3CR1 (mGFP-tagged)-Human chemokine (C-X3-C motif) receptor 1 (CX3CR1), transcript variant 3 |
CNY 5890.00 |
|
RG229931 | CX3CR1 (tGFP-tagged) - Human chemokine (C-X3-C motif) receptor 1 (CX3CR1), transcript variant 3 |
CNY 4370.00 |