Pepsinogen II (PGC) (NM_001166424) Human Untagged Clone

CAT#: SC328510

PGC (untagged)-Human progastricsin (pepsinogen C) (PGC) transcript variant 2



  "NM_001166424" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
PGII mouse monoclonal antibody,clone OTI1H5
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PEPC; PGII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328510 representing NM_001166424.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGTGGATGGTGGTGGTCTTGGTCTGCCTCCAGCTCTTGGAGGCAGCAGTGGTCAAAGTGCCCCTG
AAGAAATTTAAGTCTATCCGTGAGACCATGAAGGAGAAGGGCTTGCTGGGGGAGTTCCTGAGGACCCAC
AAGTATGATCCTGCTTGGAAGTACCGCTTTGGTGACCTCAGCGTGACCTACGAGCCCATGGCCTACATG
GATGCTGCCTACTTTGGTGAGATCAGCATCGGGACTCCACCCCAGAACTTCCTGGTCCTTTTTGACACC
GGCTCCTCCAACTTGTGGGTGCCCTCTGTCTACTGCCAGAGCCAGGCCTGCACCAGTCACTCCCGCTTC
AACCCCAGCGAGTCGTCCACCTACTCCACCAATGGGCAGACCTTCTCCCTGCAGTATGGCAGTGGCAGC
CTCACCGGCTTCTTTGGCTATGACACCCTGACTGTCCAGAGCATCCAGGTCCCCAACCAGGAGTTCGGC
TTGAGTGAGAATGAGCCTGGTACCAACTTCGTCTATGCGCAGTTTGATGGCATCATGGGCCTGGCCTAC
CCTGCTCTGTCCGTGGATGAGGCCACCACAGCTATGCAGGGCATGGTGCAGGAGGGCGCCCTCACCAGC
CCCGTCTTCAGCGTCTACCTCAGCAACCTGGTCCTGGAGTCTTCTGGTCTAGGTCCACTGCTGACCCCT
AGCAGAGCAGCTCCACCCAGCTCCACACTCCAGCTACCAGAGAAGCCTCTGGAACAAACATGGAATATC
CTTACCCCCTTCACCAAGACCCTACCTGTCTCCAATCTCAGCAGAAAAGTAACAAGCTGGGCCGGGGTG
GGGATCCCGGTGACATGTCTACCAGAGGCAGGAAGCGGAGGGGAGAGGAGAGCAGAGTGTGGGCTGGGG
GTCCCAACCACTAGGGGACCCCCCAGAAGTCAGCATCATTCGGGAGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166424
Insert Size 948 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166424.1
RefSeq Size 1152 bp
RefSeq ORF 948 bp
Locus ID 5225
UniProt ID P20142
Protein Families Protease, Secreted Protein
MW 34.2 kDa
Gene Summary This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) differs in the 3' UTR and 3' coding region, compared to variant 1. The resulting protein (isoform 2) has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...