ASB9 (NM_001168531) Human Untagged Clone
CAT＃: SC328424
ASB9 (untagged)-Human ankyrin repeat and SOCS box-containing 9 (ASB9) transcript variant 4
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001168531, the custom clone sequence may differ by one or more nucleotides
ATGGATGGCAAACAAGGGGGCATGGATGGGAGCAAGCCCGCGGGGCCAAGGGACTTTCCT GGCATCAGGCTTCTTTCAAACCCATTGATGGGCGATGCTGTGTCTGATTGGTCTCCTATG CATGAAGCTGCAATCCACGGACATCAGCTGTCTCTGAGGAACCTCATCAGCCAGGGGTGG GCTGTGAACATCATCACGGCAGATCATGTTTCCCCACTCCATGAAGCCTGTCTTGGAGGT CATCTCTCTTGTGTGAAGATTTTATTAAAGCATGGAGCTCAGGTGAATGGTGTGACAGCA GACTGGCACACTCCACTGTTTAATGCTTGTGTCAGCGGCAGCTGGGATTGTGTGAATTTG CTTCTGCAGCACGGAGCCAGCGTTCAACCTGAGAGTGATCTGGCATCCCCCATCCATGAA GCTGCTAGGAGAGGCCACGTGGAGTGTGTCAACTCTCTTATAGCTTATGGGGGCAACATT GACCATAAGATCAGCCACCTGGGCACTCCACTCTATTTGGCTTGTGAAAACCAACAGAGA GCCTGTGTCAAGAAGCTTCTGGAGTCAGGAGCGGACGTGAACCAAGGGAAAGGTCAGGAT TCCCCACTTCATGCAGTGGCCAGGACAGCCAGTGAAGAGCTGGCCTGCCTGCTCATGGAT TTTGGAGCGGACACCCAGGCCAAGAATGCTGAAGGCAAACGTCCTGTGGAGCTGGTGCCT CCAGAGAGCCCCTTGGCCCAGCTCTTCTTGGAGAGAGAAGGTGCTTCTTTGCCAAAACCT AAGCCCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001168531 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001168531.1, NP_001162003.1 |
| RefSeq Size | 1962 bp |
| RefSeq ORF | 789 bp |
| Locus ID | 140462 |
| UniProt ID | Q96DX5 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a member of the ankyrin repeat and suppressor of cytokine signaling (SOCS) box protein family. Members of this family can interact with the elongin B-C adapter complex via their SOCS box domain and further complex with the cullin and ring box proteins to form E3 ubiquitin ligase complexes. They may function to mediate the substrate-recognition of the E3 ubiquitin ligases. A transcribed pseudogene of this gene has been identified on chromosome 15. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (4) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. Both variants 2 and 4 encode the same isoform (2). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229786 | ASB9 (Myc-DDK-tagged)-Human ankyrin repeat and SOCS box containing 9 (ASB9), transcript variant 4 |
CNY 3990.00 |
|
| RC229786L3 | Lenti-ORF clone of ASB9 (Myc-DDK-tagged)-Human ankyrin repeat and SOCS box containing 9 (ASB9), transcript variant 4 |
CNY 5890.00 |
|
| RC229786L4 | Lenti-ORF clone of ASB9 (mGFP-tagged)-Human ankyrin repeat and SOCS box containing 9 (ASB9), transcript variant 4 |
CNY 5890.00 |
|
| RG229786 | ASB9 (tGFP-tagged) - Human ankyrin repeat and SOCS box containing 9 (ASB9), transcript variant 4 |
CNY 4370.00 |
