CCRK (CDK20) (NM_001170640) Human Untagged Clone
CAT#: SC328392
CDK20 (untagged)-Human cyclin-dependent kinase 20 (CDK20) transcript variant 5
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CCRK; CDCH; P42; PNQALRE |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001170640, the custom clone sequence may differ by one or more nucleotides
ATGGACCAGTACTGCATCCTGGGCCGCATCGGGGAGGGCGCCCACGGCATCGTCTTCAAG GCCAAGCACGTGGAGACTGGCGAGATAGTTGCCCTCAAGAAGGTGGCCCTAAGGCGGTTG GAGGACGGCTTCCCTAACCAGGCCCTGCGGGAGATTAAGGCTCTGCAGGAGATGGAGGAC AATCAGTATGTGGTACAACTGAAGGCTGTGTTCCCACACGGTGGAGGCTTTGTGCTGGCC TTTGAGTTCATGCTGTCGGATCTGGCCGAGGTGGTGCGCCATGCCCAGAGGCCACTAGCC CAGGCACAGGTCAAGAGCTACCTGCAGATGCTGCTCAAGGGTGTCGCCTTCTGCCATGCC AACAACATTGTACATCGGGACCTGAAACCTGCCAACCTGCTCATCAGCGCCTCAGGCCAG CTCAAGATAGCGGACTTTGGCCTGGCTCGAGTCTTTTCCCCAGACGGCAGCCGCCTCTAC ACACACCAGGTGGCCACCAGGAGCTCACTGAGCTGCCGGACTACAACAAGATCTCCTTTA AGGAGCAGGTGCCCATGCCCCTGGAGGAGGTGCTGCCTGACGTCTCTCCCCAGGCATTGG ATCTGCTGGGTCAATTCCTTCTCTACCCTCCTCACCAGCGCATCGCAGCTTCCAAGGCTC TCCTCCATCAGTACTTCTTCACAGCTCCCCTGCCTGCCCATCCATCTGAGCTGCCGATTC CTCAGCGTCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001170640 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001170640.1, NP_001164111.1 |
RefSeq Size | 2219 bp |
RefSeq ORF | 732 bp |
Locus ID | 23552 |
UniProt ID | Q8IZL9 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | The protein encoded by this gene contains a kinase domain most closely related to the cyclin-dependent protein kinases. The encoded kinase may activate cyclin-dependent kinase 2 and is involved in cell growth. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 5' coding region, and lacks an exon in the 3' coding region, which results in a frameshift compared to variant 1. This results in a shorter protein (isoform 5, also known as cardiac CCRK), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229754 | CDK20 (Myc-DDK-tagged)-Human cyclin-dependent kinase 20 (CDK20), transcript variant 5 |
CNY 3990.00 |
|
RC229754L3 | Lenti-ORF clone of CDK20 (Myc-DDK-tagged)-Human cyclin-dependent kinase 20 (CDK20), transcript variant 5 |
CNY 5890.00 |
|
RC229754L4 | Lenti-ORF clone of CDK20 (mGFP-tagged)-Human cyclin-dependent kinase 20 (CDK20), transcript variant 5 |
CNY 5890.00 |
|
RG229754 | CDK20 (tGFP-tagged) - Human cyclin-dependent kinase 20 (CDK20), transcript variant 5 |
CNY 4370.00 |