PRRG1 (NM_001173489) Human Untagged Clone

CAT#: SC328348

PRRG1 (untagged)-Human proline rich Gla (G-carboxyglutamic acid) 1 (PRRG1) transcript variant 3



  "NM_001173489" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-PRRG1 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PRGP1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001173489, the custom clone sequence may differ by one or more nucleotides
ATGGGGAGGGTTTTCCTCACGGGAGAAAAAGCCAATTCCATATTAAAACGCTACCCAAGA
GCTAATGGGTTTTTTGAAGAAATAAGACAGGGCAACATTGAGCGTGAGTGCAAAGAAGAA
TTCTGTACATTTGAAGAAGCAAGAGAAGCTTTTGAAAATAATGAAAAAACTAAGGAGTTT
TGGAGCACCTACACAAAAGCGCAACAAGGGGAGAGTAACCGAGGAAGTGACTGGTTTCAG
TTTTACCTTACCTTTCCGTTAATCTTTGGCCTCTTCATTATCCTCCTTGTCATTTTCCTA
ATCTGGAGATGCTTCCTAAGAAACAAAACTCGTAGACAGACAGTGACTGAAGGCCACATT
CCTTTCCCTCAGCACCTTAATATTATCACCCCACCCCCCCCACCAGATGAAGTGTTTGAC
AGCAGTGGATTGTCTCCAGGCTTTCTGGGATATGTAGTTGGGCGCTCAGATTCCGTCTCT
ACTCGCCTGTCCAATTGTGATCCCCCGCCAACCTATGAGGAAGCCACTGGCCAAGTGAAC
CTGCAGAGGAGTGAAACAGAACCTCATTTAGACCCACCCCCAGAGTATGAGGACATAGTC
AACTCCAACTCAGCCAGTGCCATTCCTATGGTGCCTGTGGTCACCACCATCAAATGA
Restriction Sites Please inquire     
ACCN NM_001173489
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001173489.1, NP_001166960.1
RefSeq Size 4618 bp
RefSeq ORF 657 bp
Locus ID 5638
UniProt ID O14668
Protein Families Transmembrane
Gene Summary This gene encodes a vitamin K-dependent, gamma-carboxyglutamic acid (Gla)-containing, single-pass transmembrane protein. This protein contains a Gla domain at the N-terminus, preceded by a propeptide sequence required for post-translational gamma-carboxylation of specific glutamic acid residues by a vitamin K-dependent gamma-carboxylase. The C-terminus is proline-rich containing PPXY and PXXP motifs found in a variety of signaling and cytoskeletal proteins. This gene is highly expressed in the spinal cord. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (3) uses an alternative donor splice site at the 5' terminal non-coding exon compared to variant 1. Variants 1-4 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...