TSFM (NM_001172697) Human Untagged Clone
CAT#: SC328343
TSFM (untagged)-Human Ts translation elongation factor mitochondrial (TSFM) nuclear gene encoding mitochondrial protein transcript variant 4
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EFTS; EFTSMT |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001172697, the custom clone sequence may differ by one or more nucleotides
ATGTCGCTGCTGCGGTCGCTGCGCGTGTTTCTGGTCGCGCGGACCGGGAGCTACCCGGCT GGGTCTCTTCTGCGTCAGTCGCCCCAGCCAAGGCACACATTTTATGCTGGGCCCCGTCTG TCTGCCTCGGCCTCCAGCAAGGAGCTCCTCATGAAGCTGCGGCGGAAAACAGGCTACTCC TTTGTAAATTGCAAGAAAGCTCTGGAGACTTGTGGCGGGGACCTCAAACAGGCAGAGATC TGGCTCCACAAGGAGGCCCAGAAGGAGGGCTGGAGCAAAGCTGCCAAGCTCCAAGGGAGG AAGACCAAAGAAGGCCTGATTGGGCTGTTGCAGGAAGGAAACACAACTGTATTAGTAGAG GTAAACTGTGAGACAGATTTTGTTTCTAGAAATTTAAAATTTCAACTGTTGGTCCAGCAA GTAGCCCTTGGAACCATGATGCATTGTCAGACCCTAAAGGATCAACCCTCTGCATACAGT AAAGGTTTCTTGAATTCCTCTGAGCTTTCTGGACTTCCAGCTGGGCCTGACAGAGAAGGC TCACTCAAGGATCAGTTGGCTTTAGCAATTGGTCTGCCTTTCCAAATTGGAGCTGTCTCT GAACTTCAGCTTCCTGAATCCAACTTCTTGCAGAACACCTCCTCTTGA |
Restriction Sites | Please inquire |
ACCN | NM_001172697 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001172697.1, NP_001166168.1 |
RefSeq Size | 930 bp |
RefSeq ORF | 648 bp |
Locus ID | 10102 |
UniProt ID | P43897 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a mitochondrial translation elongation factor. The encoded protein is an enzyme that catalyzes the exchange of guanine nucleotides on the translation elongation factor Tu during the elongation step of mitchondrial protein translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-3 syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010] Transcript Variant: This variant (4) differs in the 3' UTR and has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift. The resulting protein (isoform 4) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229705 | TSFM (Myc-DDK-tagged)-Human Ts translation elongation factor, mitochondrial (TSFM), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 3990.00 |
|
RC229705L3 | Lenti-ORF clone of TSFM (Myc-DDK-tagged)-Human Ts translation elongation factor, mitochondrial (TSFM), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 5890.00 |
|
RC229705L4 | Lenti-ORF clone of TSFM (mGFP-tagged)-Human Ts translation elongation factor, mitochondrial (TSFM), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 5890.00 |
|
RG229705 | TSFM (tGFP-tagged) - Human Ts translation elongation factor, mitochondrial (TSFM), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 4370.00 |