VIT (NM_001177972) Human Untagged Clone

CAT#: SC328319

VIT (untagged)-Human vitrin (VIT) transcript variant 5



  "NM_001177972" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms VIT1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001177972, the custom clone sequence may differ by one or more nucleotides
ATGAGGACTGTTGTTCTCACTATGAAGGCATCTGTTATTGAAATGTTCCTTGTTTTGCTG
GTGACTGGAGTACATTCAAACAAAGAAACGGCAAAGAAGATTAAAAGGCCCAAGTTCACT
GTGCCTCAGATCAACTGCGATGTCAAAGCCGGAAAGATCATCGATCCTGAGTTCATTGTG
AAATGTCCAGCAGGATGCCAAGACCCCAAATACCATGTTTATGGCACTGACGTGTATGCA
TCCTACTCCAGTGTGTGTGGCGCTGCCGTACACAGTGGTGTGCTTGATAATTCAGGAGGG
AAAATACTTGTTCGGAAGGTTGCTGGACAGTCTGGTTACAAAGGGAGTTATTCCAACGGT
GTCCAATCGTTATCCCTACCACGATGGAGAGAATCCTTTATCGTCTTAGAAAGTAAACCC
AAAAAGGGTGTAACCTACCCATCAGCTCTTACATACTCATCATCGAAAAGTCCAGCTGCC
CAAGCAGGCAAGTGCTCACGTGTGATTGAATCTAAACCTTCTGAGTCCATGAACACGCGA
CGTGTTTTGGGAGATAGCGGAGAAATTAACATCTTAACCGGTCAAGCTCCACTGGCTCTG
GCAATATTTTAA
Restriction Sites Please inquire     
ACCN NM_001177972
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001177972.1, NP_001171443.1
RefSeq Size 1433 bp
RefSeq ORF 612 bp
Locus ID 5212
UniProt ID Q6UXI7
Protein Families Secreted Protein
Gene Summary This gene encodes an extracellular matrix (ECM) protein. The protein may be associated with cell adhesion and migration. High levels of expression of the protein in specific parts of the brain suggest its likely role in neural development. [provided by RefSeq, Jun 2016]
Transcript Variant: This variant (5) contains an alternate segment at its 3' end compared to variant 1. The resulting protein (isoform 5) is shorter and has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...