PAFAH1B2 (NM_001184746) Human Untagged Clone
CAT＃: SC328318
PAFAH1B2 (untagged)-Human platelet-activating factor acetylhydrolase 1b catalytic subunit 2 (30kDa) (PAFAH1B2) transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HEL-S-303 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001184746, the custom clone sequence may differ by one or more nucleotides
ATGAGCCAAGGAGACTCAAACCCAGCAGCTATTCCGCATGCAGCAGAAGATATTCAAGGA GATGACCGATGGATGTCTCAGCACAACAGATTTGTTTTGGACTGTAAAGACAAAGAGCCT GATGTACTGTTCGTGGGAGACTCCATGGTGCAGTTAATGCAGCAATATGAGATATGGCGA GAGCTTTTTTCCCCACTTCATGCACTGAATTTTGGAATTGGGGGAGATACAACAAGACAT GTTTTGTGGAGACTAAAGAATGGAGAACTGGAGAATATTAAGCCTAAGGTCATTGTTGTC TGGGTAGGAACAAATAACCACGAAAATACAGCAGAAGAAGTAGCAGGTGGGATCGAGGCC ATTGTACAACTTATCAACACAAGGCAGCCACAGGCCAAAATCATTGTATTGGGTAAAGCA GCCGCCTCCAAATACTCTATCTCAGAGATAGTGAGACTAGAACAAGGGTCGGTTAACTGG TCGATCGGGACCTATCCTGATGACACACCAGCAACTACCAGGCCAGCAATATTACAATTA TTTACTGGCAAGATGAGCAGGATTACCATGAAAGAAAAGTCCAGATGGACTGAGGAAATC CTACACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001184746 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001184746.1, NP_001171675.1 |
| RefSeq Size | 1195 bp |
| RefSeq ORF | 609 bp |
| Locus ID | 5049 |
| UniProt ID | P68402 |
| Protein Pathways | Ether lipid metabolism, Metabolic pathways |
| Gene Summary | Platelet-activating factor acetylhydrolase (PAFAH) inactivates platelet-activating factor (PAF) into acetate and LYSO-PAF. This gene encodes the beta subunit of PAFAH, the other subunits are alpha and gamma. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (2) contains different segments for its 3' end, compared to variant 1. The resulting protein (isoform b) has a shorter and distinct C-terminus when it is compared to isoform a. This variant has also been called SpV-2 in PubMed ID: 18155631. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229680 | PAFAH1B2 (Myc-DDK-tagged)-Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) (PAFAH1B2), transcript variant 2 |
CNY 3990.00 |
|
| RC229680L3 | Lenti-ORF clone of PAFAH1B2 (Myc-DDK-tagged)-Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) (PAFAH1B2), transcript variant 2 |
CNY 5890.00 |
|
| RC229680L4 | Lenti-ORF clone of PAFAH1B2 (mGFP-tagged)-Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) (PAFAH1B2), transcript variant 2 |
CNY 5890.00 |
|
| RG229680 | PAFAH1B2 (tGFP-tagged) - Human platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) (PAFAH1B2), transcript variant 2 |
CNY 4370.00 |
其它PAFAH1B2产品
