ASTN2 (NM_001184735) Human Untagged Clone

CAT#: SC328307

ASTN2 (untagged)-Human astrotactin 2 (ASTN2) transcript variant 6



  "NM_001184735" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ASTN2 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA67K19.1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001184735, the custom clone sequence may differ by one or more nucleotides
ATGCCCTTCATCACCTACCTCTCAGGTTTGCTGACAGCCCAGATGCTGTCAGATGACCAG
CTCATTTCAGGTGTGGAGATTCGCTGTGAGGAGAAGGGGCGCTGTCCATCTACCTGTCAC
CTTTGCCGCCGGCCAGGCAAGGAGCAGCTGAGCCCCACACCAGTGCTGCTGGAAATCAAC
CGTGTGGTGCCACTTTATACCCTCATCCAAGACAATGGCACAAAGGAGGCCTTCAAGAGT
GCACTGATGAGTTCCTACTGGTGCTCAGGGAAAGGGGATGTGATCGATGACTGGTGCAGG
TGTGACCTCAGCGCCTTTGATGCCAATGGGCTCCCCAACTGCAGCCCCCTTCTGCAGCCG
GTGCTGCGGCTGTCCCCAACAGTGGAGCCCTCCAGTACTGTGGTCTCCTTGGAGTGGGTG
GATGTTCAGCCAGCTATTGGGACCAAGGTCTCCGACTATATTCTGCAGCATAAGAAAGTG
GATGAATACACAGACACTGACCTGTACACAGTTTATTGCTGGATTACATTTATTGATTTG
CGGATATTGAACCAGCCTTGCATCCCAGGGATGAAGCCAACTTGA
Restriction Sites Please inquire     
ACCN NM_001184735
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001184735.1, NP_001171664.1
RefSeq Size 3519 bp
RefSeq ORF 585 bp
Locus ID 23245
Protein Families Transmembrane
Gene Summary This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
Transcript Variant: This variant (6) has multiple differences compared to variant 1. These differences result in a distinct 5' UTR and lead to translation initiation at an alternate start codon, compared to variant 1. The encoded isoform (f) has distinct N- and C-termini and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...