RNF4 (NM_001185009) Human Untagged Clone

CAT#: SC328297

RNF4 (untagged)-Human ring finger protein 4 (RNF4) transcript variant 1



  "NM_001185009" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
RNF4 mouse monoclonal antibody,clone OTI1F6
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RES4-26; SLX5; SNURF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328297 representing NM_001185009.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTACAAGAAAGCGTCGTGGTGGAGCAATAAATTCTAGACAAGCTCAGAAGCGAACTCGGGAAGCA
ACCTCCACCCCCGAGATCTCCTTGGAAGCAGAACCCATAGAACTCGTGGAAACTGCTGGAGATGAAATT
GTGGACCTCACTTGTGAATCTTTAGAGCCTGTGGTGGTTGATCTGACTCACAATGACTCTGTTGTGATT
GTTGACGAAAGAAGAAGACCAAGGAGGAATGCTAGGAGGCTGCCCCAGGACCATGCTGACAGCTGTGTG
GTGAGCAGTGACGATGAGGAGTTGTCCAGGGACAGAGACGTATATGTGACTACCCATACTCCCAGAAAC
GCCAGGGATGAGGGCGCTACAGGCCTCAGGCCCTCAGGTACTGTCAGTTGTCCCATCTGCATGGACGGA
TACTCAGAGATCGTGCAGAATGGACGTCTCATCGTTTCCACAGAATGCGGCCATGTCTTCTGTAGCCAG
TGCCTCCGTGATTCCCTGAAGAATGCTAATACTTGCCCAACTTGTAGGAAAAAGATCAACCACAAACGG
TACCACCCCATTTATATATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001185009
Insert Size 573 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001185009.1
RefSeq Size 3493 bp
RefSeq ORF 573 bp
Locus ID 6047
UniProt ID P78317
Protein Families Transcription Factors
MW 21.3 kDa
Gene Summary The protein encoded by this gene contains a RING finger motif and acts as a transcription regulator. This protein has been shown to interact with, and inhibit the activity of, TRPS1, a transcription suppressor of GATA-mediated transcription. Transcription repressor ZNF278/PATZ is found to interact with this protein, and thus reduce the enhancement of androgen receptor-dependent transcription mediated by this protein. Studies of the mouse and rat counterparts suggested a role of this protein in spermatogenesis. A pseudogene of this gene is found on chromosome 1.[provided by RefSeq, Jul 2010]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Both variants 1 and 2 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...