ZC4H2 (NM_001178033) Human Untagged Clone
CAT#: SC328278
ZC4H2 (untagged)-Human zinc finger C4H2 domain containing (ZC4H2) transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HCA127; KIAA1166; MCS; MRXS4; WRWF; WRWFFR; WWS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328278 representing NM_001178033.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAGATGAGCAAGAAATCATGTGCAAATTGGAAAGCATTAAAGAGATCAGGAACAAGACCCTGCAG ATGGAGAAGATCAAGGCTCGTTTGAAGGCTGAGTTTGAGGCACTTGAGTCAGAGGAAAGGCACCTGAAG GAATACAAGCAGGAGATGGACCTTCTGCTACAGGAGAAGATGGCCCATGTGGAGGAACTCCGACTGATC CACGCTGACATCAATGTGATGGAAAACACTATCAAACAATCTGAGAATGACCTAAACAAGCTGCTAGAG TCTACAAGGAGGCTGCATGATGAGTATAAGCCACTGAAAGAACATGTGGATGCCCTGCGCATGACTCTG GGCCTGCAGAGGCTCCCTGACTTGTGTGAAGAAGAGGAGAAGCTTTCCTTGGAGCCTGCTTGTCATGTC ACCAGCAAATTCACCGGAATGCACCTATATGCCCTCTTTGCAAGGCCAAGAGTCGGTCCCGGAACCCCA AAAAGCCGAAACGGAAGCAGGATGAATAAAGAAAGGGAGAGCACATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001178033 |
Insert Size | 531 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001178033.2 |
RefSeq Size | 2649 bp |
RefSeq ORF | 531 bp |
Locus ID | 55906 |
UniProt ID | Q9NQZ6 |
MW | 20.6 kDa |
Gene Summary | This gene encodes a member of the zinc finger domain-containing protein family. This family member has a C-terminal zinc finger domain that is characterized by four cysteine residues and two histidine residues, and it also includes a coiled-coil region. This protein has been detected as an autoantigen in hepatocellular carcinoma patients. This gene has been identified as a potential candidate for X-linked cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) lacks an alternate exon in the 3' coding region that results in a frameshift, compared to variant 1. The resulting isoform (3) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229640 | ZC4H2 (Myc-DDK-tagged)-Human zinc finger, C4H2 domain containing (ZC4H2), transcript variant 3 |
CNY 2400.00 |
|
RC229640L3 | Lenti ORF clone of Human zinc finger, C4H2 domain containing (ZC4H2), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC229640L4 | Lenti ORF clone of Human zinc finger, C4H2 domain containing (ZC4H2), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG229640 | ZC4H2 (tGFP-tagged) - Human zinc finger, C4H2 domain containing (ZC4H2), transcript variant 3 |
CNY 4370.00 |