HDAC8 (NM_001166422) Human Untagged Clone
CAT#: SC328246
HDAC8 (untagged)-Human histone deacetylase 8 (HDAC8) transcript variant 5
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDA07; CDLS5; HD8; HDACL1; KDAC8; MRXS6; RPD3; WTS |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001166422, the custom clone sequence may differ by one or more nucleotides
ATGGAGGAGCCGGAGGAACCGGCGGACAGTGGGCAGTCGCTGGTCCCGGTTTATATCTAT AGTCCCGAGTATGTCAGTATGTGTGACTCCCTGGCCAAGATCCCCAAACGGGCCAGTATG GTGCATTCTTTGATTGAAGCATATGCACTGCATAAGCAGATGAGGATAGTTAAGCCTAAA GTGGCCTCCATGGAGGAGATGGCCACCTTCCACACTGATGCTTATCTGCAGCATCTCCAG AAGGTCAGCCAAGAGGGCGATGATGATCATCCGGACTCCATAGAATATGGGCTAGGTTAT GACTGCCCAGCCACTGAAGGGATATTTGACTATGCAGCAGCTATAGGAGGGGCTACGATC ACAGCTGCCCAATGCCTGATTGACGGAATGTGCAAAGTAGCAATTAACTGGTCTGGAGGG TGGCATCATGCAAAGAAAGAGACGTGTGTGTATGTGGCACTTTACAAGGCATTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001166422 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001166422.1, NP_001159894.1 |
RefSeq Size | 1033 bp |
RefSeq ORF | 477 bp |
Locus ID | 55869 |
UniProt ID | Q9BY41 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (5) lacks multiple alternate 3' exons and uses an alternate 3' terminal exon, compared to variant 1. The encoded isoform (5) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: A downstream translational start codon is selected for this RefSeq based on a strong Kozak signal and transcript support. An upstream in-frame start codon is also present but has a weaker Kozak signal and sparse transcript support. Use of the upstream start codon would result in a protein that is 38 aa longer at the N-terminus. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon, which is supported by 5'RACE experiments described in PubMed: 10922473 and encodes a protein with an N-terminus similar to other family members. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229608 | HDAC8 (Myc-DDK-tagged)-Human histone deacetylase 8 (HDAC8), transcript variant 5 |
CNY 3990.00 |
|
RC229608L3 | Lenti-ORF clone of HDAC8 (Myc-DDK-tagged)-Human histone deacetylase 8 (HDAC8), transcript variant 5 |
CNY 5890.00 |
|
RC229608L4 | Lenti-ORF clone of HDAC8 (mGFP-tagged)-Human histone deacetylase 8 (HDAC8), transcript variant 5 |
CNY 5890.00 |
|
RG229608 | HDAC8 (tGFP-tagged) - Human histone deacetylase 8 (HDAC8), transcript variant 5 |
CNY 4370.00 |