RNF4 (NM_001185010) Human Untagged Clone
CAT#: SC328182
RNF4 (untagged)-Human ring finger protein 4 (RNF4) transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RES4-26; SLX5; SNURF |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001185010, the custom clone sequence may differ by one or more nucleotides
ATGAGTACAAGAAAGCGTCGTGGTGGAGCAATAAATTCTAGACAAGCTCAGAAGCGAACT CGGGAAGCAACCTCCACCCCCGAGATCTCCTTGGAAGCAGAACCCATAGAACTCGTGGAA ACTGCTGGAGATGAAATTGTGGACCTCACTTGTGAATCTTTAGAGCCTGTGGTGGTTGAT CTGACTCACAATGACTCTGTTGTGATTGTTGACGGCCCTCAGGTACTGTCAGTTGTCCCA TCTGCATGGACGGATACTCAGAGATCGTGCAGAATGGACGTCTCATCGTTTCCACAGAAT GCGGCCATGTCTTCTGTAGCCAGTGCCTCCGTGATTCCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001185010 |
Insert Size | 2811 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001185010.1, NP_001171939.1 |
RefSeq Size | 2811 bp |
RefSeq ORF | 2811 bp |
Locus ID | 6047 |
UniProt ID | P78317 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene contains a RING finger motif and acts as a transcription regulator. This protein has been shown to interact with, and inhibit the activity of, TRPS1, a transcription suppressor of GATA-mediated transcription. Transcription repressor ZNF278/PATZ is found to interact with this protein, and thus reduce the enhancement of androgen receptor-dependent transcription mediated by this protein. Studies of the mouse and rat counterparts suggested a role of this protein in spermatogenesis. A pseudogene of this gene is found on chromosome 1.[provided by RefSeq, Jul 2010] Transcript Variant: This variant (3) differs in the 5' UTR and lacks an alternate exon in the 3' coding region which results in a frameshift, compared to variant 1. The resulting protein (isoform 2) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229544 | RNF4 (Myc-DDK-tagged)-Human ring finger protein 4 (RNF4), transcript variant 3 |
CNY 1200.00 |
|
RC229544L3 | Lenti-ORF clone of RNF4 (Myc-DDK-tagged)-Human ring finger protein 4 (RNF4), transcript variant 3 |
CNY 5890.00 |
|
RC229544L4 | Lenti-ORF clone of RNF4 (mGFP-tagged)-Human ring finger protein 4 (RNF4), transcript variant 3 |
CNY 5890.00 |
|
RG229544 | RNF4 (tGFP-tagged) - Human ring finger protein 4 (RNF4), transcript variant 3 |
CNY 4370.00 |