PET100 (NM_001171155) Human Untagged Clone
CAT＃: SC328135
PET100 (untagged)-Human similar to hCG2036585 (LOC100131801) transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C19orf79; MC4DN12 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC328135 representing NM_001171155.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGGTGAAGCTGGAGATATTTCGGATGATAATCTACCTCACTTTCCCTGTGGCTATGTTCTGGGTT TCCAATCAGGCCGAGTGGTTTGAGGACGATGTCATACAGCGCAAGAGGGAGCTGTGGCCACCTGAGAAG CTTCAAGAGATAGAGGAATTCAAAGAGAGGTTACGGAAGCGGCGGGAGGAGAAGCTCCTTCGCGACGCC CAGCAGAACTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001171155 |
| Insert Size | 222 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001171155.1 |
| RefSeq Size | 349 bp |
| RefSeq ORF | 222 bp |
| Locus ID | 100131801 |
| UniProt ID | P0DJ07 |
| MW | 9.1 kDa |
| Gene Summary | Mitochondrial complex IV, or cytochrome c oxidase, is a large transmembrane protein complex that is part of the respiratory electron transport chain of mitochondria. The small protein encoded by this gene plays a role in the biogenesis of mitochondrial complex IV. This protein localizes to the inner mitochondrial membrane and is exposed to the intermembrane space. Mutations in this gene are associated with mitochondrial complex IV deficiency. This gene has a pseudogene on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (1) represents the shorter transcript and encodes the functional protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229497 | PET100 (Myc-DDK-tagged)-Human hypothetical protein LOC100131801 (LOC100131801), transcript variant 1 |
CNY 1200.00 |
|
| RC229497L3 | Lenti ORF clone of Human hypothetical protein LOC100131801 (LOC100131801), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC229497L4 | Lenti ORF clone of Human hypothetical protein LOC100131801 (LOC100131801), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG229497 | PET100 (tGFP-tagged) - Human hypothetical protein LOC100131801 (LOC100131801), transcript variant 1 |
CNY 4370.00 |
