NUSAP1 (NM_016359) Human Untagged Clone
CAT#: SC327860
NUSAP1 (untagged)-Human nucleolar and spindle associated protein 1 (NUSAP1) transcript variant 1
CNY 7220.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ANKT; BM037; LNP; NUSAP; PRO0310p1; Q0310; SAPL |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_016359, the custom clone sequence may differ by one or more nucleotides
ATGATCATCCCCTCTCTAGAGGAGCTGGACTCCCTCAAGTACAGTGACCTGCAGAACTTA GCCAAGAGTCTGGGTCTCCGGGCCAACCTGAGGGCAACCAAGTTGTTAAAAGCCTTGAAA GGCTACATTAAACATGAGGCAAGAAAAGGAAATGAGAATCAGGATGAAAGTCAAACTTCT GCATCCTCTTGTGATGAGACTGAGATACAGATCAGCAACCAGGAAGAAGCTGAGAGACAG CCACTTGGCCATGTCACCAAAACAAGGAGAAGGTGCAAGACTGTCCGTGTGGACCCTGAC TCACAGCAGAATCATTCAGAGATAAAAATAAGTAATCCCACTGAATTCCAGAATCATGAA AAGCAGGAAAGCCAGGATCTCAGAGCTACTGCAAAAGTTCCTTCTCCACCAGACGAGCAC CAAGAAGCTGAGAATGCTGTTTCCTCAGGTAACAGAGATTCAAAGGTACCTTCAGAAGGA AAGAAATCTCTCTACACAGATGAGTCATCCAAACCTGGAAAAAATAAAAGAACTGCAATC ACTACTCCAAACTTTAAGAAGCTTCATGAAGCTCATTTTAAGGAAATGGAGTCCATTGAT CAATATATTGAGAGAAAAAAGAAACATTTTGAAGAACACAATTCCATGAATGAACTGAAG CAGCAGCCCATCAATAAGGGAGGGGTCAGGACTCCAGTACCTCCAAGAGGAAGACTCTCT GTGGCTTCTACTCCCATCAGCCAACGACGCTCGCAAGGCCGGTCTTGTGGCCCTGCAAGT CAGAGTACCTTGGGTCTGAAGGGGTCACTCAAGCGCTCTGCTATCTCTGCAGCTAAAACG GGTGTCAGGTTTTCAGCTGCTACTAAAGATAATGAGCATAAGCGTTCACTGACCAAGACT CCAGCCAGAAAGTCTGCACATGTGACCGTGTCTGGGGGCACCCCAAAAGGCGAGGCTGTG CTTGGGACACACAAATTAAAGACCATCACGGGGAATTCTGCTGCTGTTATTACCCCATTC AAGTTGACAACTGAGGCAACGCAGACTCCAGTCTCCAATAAGAAACCAGTGTTTGATCTT AAAGCAAGTTTGTCTCGTCCCCTCAACTATGAACCACACAAAGGAAAGCTAAAACCATGG GGGCAATCTAAAGAAAATAATTATCTAAATCAACATGTCAACAGAATTAACTTCTACAAG AAAACTTACAAACAACCCCATCTCCAGACAAAGGAAGAGCAACGGAAGAAACGCGAGCAA GAACGAAAGGAGAAGAAAGCAAAGGTTTTGGGAATGCGAAGGGGCCTCATTTTGGCTGAA GAT |
| Restriction Sites | Please inquire |
| ACCN | NM_016359 |
| Insert Size | 2471 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_016359.3, NP_057443.2 |
| RefSeq Size | 2471 bp |
| RefSeq ORF | 1326 bp |
| Locus ID | 51203 |
| UniProt ID | Q9BXS6 |
| Gene Summary | NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]).[supplied by OMIM, Jun 2009] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
MicroRNA-769-5p suppresses cell growth and migration via targeting NUSAP1 in bladder cancer
,Chen, Y;Zhang, W;Kadier, A;Zhang, H;Yao, X;,
J. Clin. Lab. Anal.
,PubMed ID 31901150
[NUSAP1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219159 | NUSAP1 (Myc-DDK-tagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 |
CNY 4370.00 |
|
| RC219159L1 | Lenti-ORF clone of NUSAP1 (Myc-DDK-tagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 |
CNY 6270.00 |
|
| RC219159L2 | Lenti-ORF clone of NUSAP1 (mGFP-tagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 |
CNY 6270.00 |
|
| RC219159L3 | Lenti-ORF clone of NUSAP1 (Myc-DDK-tagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 |
CNY 6270.00 |
|
| RC219159L4 | Lenti-ORF clone of NUSAP1 (mGFP-tagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 |
CNY 6270.00 |
|
| RG219159 | NUSAP1 (tGFP-tagged) - Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 |
CNY 5256.00 |
|
| SC114338 | NUSAP1 (untagged)-Human nucleolar and spindle associated protein 1 (NUSAP1), transcript variant 1 |
CNY 2400.00 |
