TMEM64 (NM_001008495) Human Untagged Clone

CAT#: SC327817

TMEM64 (untagged)-Human transmembrane protein 64 (TMEM64) transcript variant 1



  "NM_001008495" in other vectors (7)

CNY 6180.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327817 representing NM_001008495.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGGAGCCCGGGCGGGATCCTGCTCCAGGCGCTGCCCCGGCTGCTGCAGCACGCCGCCCTCCCGGGC
CTCGCCGAGCTGCCGGCCCGCTGGGCCCTGCCGCGGGGTGCGGGCGGGGACGGCCCGGCGGACCGCCTT
CCCCGCGGGGGCGGGGCGAGCGCGGCGGCGGCAGCAGCGGCGGCCTCGGGCGCCCTGCTCGGCGCCTAT
CTGGAGCGCCACGGTCCGCCCGAGGCTTCGGAGCTGCCGGAGCCGGGCGGGGCCTTGGCGGGCGGCCCC
GGGAGTGGCGGCGGCGGCGTGGTGGTCGGCGTGGCTGAGGTGAGAAACTGGCGCTGCTGCTGCCTCGGC
AGCACCTGTTGGTGCCGGAGCCTCGTGCTGGTCTGCGTGTTGGCCGCCCTGTGCTTCGCTTCCCTGGCC
CTGGTCCGCCGCTACCTTCACCACCTCCTGCTGTGGGTGGAGAGCCTTGACTCGCTGCTGGGGGTCCTG
CTCTTCGTCGTGGGCTTCATCGTGGTCTCTTTCCCCTGCGGCTGGGGCTACATCGTGCTCAACGTGGCC
GCTGGCTACCTGTACGGCTTCGTGCTGGGCATGGGTCTGATGATGGTGGGCGTCCTCATCGGCACCTTC
ATCGCCCATGTGGTCTGCAAGCGGCTCCTCACCGCCTGGGTGGCCGCCAGGATCCAGAGCAGCGAGAAG
CTGAGCGCGGTTATTCGCGTAGTGGAGGGAGGAAGCGGCCTGAAAGTGGTGGCGCTGGCCAGACTGACA
CCCATACCTTTTGGGCTTCAGAATGCAGTGTTTTCGATTACTGATCTCTCATTACCCAACTATCTGATG
GCATCTTCGGTTGGACTGCTTCCTACCCAGCTTCTGAATTCTTACTTGGGTACCACCCTGCGGACAATG
GAAGATGTCATTGCAGAACAGAGTGTTAGTGGATATTTTGTTTTTTGTTTACAGATTATTATAAGTATA
GGCCTCATGTTTTATGTAGTTCATCGAGCTCAAGTGGAATTGAATGCAGCTATTGTAGCTTGTGAAATG
GAACTGAAATCTTCTCTGGTTAAAGGCAATCAACCAAATACCAGTGGCTCTTCATTCTACAACAAGAGG
ACCCTAACATTTTCTGGAGGTGGAATCAATGTTGTATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001008495
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001008495.3
RefSeq Size 4819 bp
RefSeq ORF 1143 bp
Locus ID 169200
UniProt ID Q6YI46
Protein Families Transmembrane
MW 39.7 kDa
Gene Summary Positively regulates TNFSF11-induced osteoclast differentiation. Acts as a regulator of TNFSF11-mediated Ca(2+) signaling pathways via its interaction with SERCA2 which is critical for the TNFSF11-induced CREB1 activation and mitochondrial ROS generation necessary for proper osteoclast generation. Association between TMEM64 and SERCA2 in the ER leads to cytosolic Ca (2+) spiking for activation of NFATC1 and production of mitochondrial ROS, thereby triggering Ca (2+) signaling cascades that promote osteoclast differentiation and activation. Negatively regulates osteoblast differentiation and positively regulates adipocyte differentiation via modulation of the canonical Wnt signaling pathway. Mediates the switch in lineage commitment to osteogenesis rather than to adipogenesis in mesenchymal stem cells by negatively regulating the expression, activity and nuclear localization of CTNNB1.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...