RFC5 (NM_181578) Human Untagged Clone
CAT#: SC327793
RFC5 (untagged)-Human replication factor C (activator 1) 5 36.5kDa (RFC5) transcript variant 2
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RFC36 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_181578, the custom clone sequence may differ by one or more nucleotides
ATGGTTGAAAAATACCGGCCACAGACCCTGAATGATCTCATTTCTCATCAGGACATTCTG AGTACCATTCAGAAGTTTATCAATGAAGACCGACTGCCACACTTGCTTCTCTACGGTCCC CCAGGGACAGGCAAGACATCTACCATCCTAGCCTGTGCGAAACAGCTATATAAAGACAAA GAATTTGGCTCCATGGTCTTGGAGCTGAATGCTTCAGATGACCGAGGAATAGACATCATT CGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAAGAAAGGCTTTAAGCTA GTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAGAATGCCTTGAGAAGAGTA ATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATC ATCCCTGCCTTGCAGTCCCGCTGCACGAGGTTTCGGTTCGGTCCCCTGACTCCTGAACTC ATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAAAGTTGATATAAGTGAAGATGGA ATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG AGCACCAATATGGCCTTTGGGAAGGTGACAGAGGAGACTGTCTACACCTGCACCGGGCAC CCGCTCAAGTCAGACATTGCCAACATCCTGGACTGGATGTTGAATCAAGATTTCACCACA GCCTACAGAAATATTACAGAGTTGAAAACTCTGAAGGGGTTGGCACTGCATGATATCCTG ACAGAGATACACTTGTTTGTGCATAGAGTTGACTTTCCATCTTCAGTTCGAATACATTTA TTGACCAAAATGGCAGACATTGAGTACAGGCTTTCTGTTGGCACCAACGAGAAGATCCAG CTGAGCTCCCTCATTGCTGCATTTCAAGTCACCAGAGACCTGATTGTTGCAGAGGCC |
Restriction Sites | Please inquire |
ACCN | NM_181578 |
Insert Size | 2486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_181578.2, NP_853556.2 |
RefSeq Size | 2486 bp |
RefSeq ORF | 960 bp |
Locus ID | 5985 |
UniProt ID | P40937 |
Protein Families | Stem cell - Pluripotency |
Protein Pathways | DNA replication, Mismatch repair, Nucleotide excision repair |
Gene Summary | This gene encodes the smallest subunit of the replication factor C complex, which consists of five distinct subunits (140, 40, 38, 37, and 36 kDa) and is required for DNA replication. This subunit interacts with the C-terminal region of proliferating cell nuclear antigen and is required to open and load proliferating cell nuclear antigen onto DNA during S phase. It is a member of the AAA+ (ATPases associated with various cellular activities) ATPase family and forms a core complex with the 38 and 40 kDa subunits that possesses DNA-dependent ATPase activity. A related pseudogene has been identified on chromosome 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016] Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The resulting isoform (2) has a distinct and shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229158 | RFC5 (Myc-DDK-tagged)-Human replication factor C (activator 1) 5, 36.5kDa (RFC5), transcript variant 2 |
CNY 3990.00 |
|
RC229158L3 | Lenti-ORF clone of RFC5 (Myc-DDK-tagged)-Human replication factor C (activator 1) 5, 36.5kDa (RFC5), transcript variant 2 |
CNY 5890.00 |
|
RC229158L4 | Lenti-ORF clone of RFC5 (mGFP-tagged)-Human replication factor C (activator 1) 5, 36.5kDa (RFC5), transcript variant 2 |
CNY 5890.00 |
|
RG229158 | RFC5 (tGFP-tagged) - Human replication factor C (activator 1) 5, 36.5kDa (RFC5), transcript variant 2 |
CNY 4370.00 |
|
SC109725 | RFC5 (untagged)-Human replication factor C (activator 1) 5, 36.5kDa (RFC5), transcript variant 2 |
CNY 2400.00 |
|
SC324375 | RFC5 (untagged)-Human replication factor C (activator 1) 5, 36.5kDa (RFC5), transcript variant 2 |
CNY 2400.00 |