Claudin 5 (CLDN5) (NM_003277) Human Untagged Clone
CAT#: SC327783
CLDN5 (untagged)-Human claudin 5 (CLDN5) transcript variant 2
CNY 6270.00
Product images
                    
                
                                                
                                                
                                                
                                                    CNY 1999.00 
                                                    
                                                    CNY 2700.00
                                                
                                            
Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | AWAL; BEC1; CPETRL1; TMDVCF; TMVCF | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >SC327783 representing NM_003277. 
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACCCGCGCACGGATTGGCTGCTTCGGGCCGGGGGGCCGGGCCCGGGGGACAGAATCCGCCCCCGAA CCTTCAAAGAGGGTACCCCCCGGCAGGAGCTGGCAGACCCAGGAGGTGCGACAGACCCGCGGGGCAAAC GGACTGGGGCCAAGAGCCGGGAGCGCGGGCGCAAAGGCACCAGGGCCCGCCCAGGGCGCCGCGCAGCAC GGCCTTGGGGGTTCTGCGGGCCTTCGGGTGCGCGTCTCGCCTCTAGCCATGGGGTCCGCAGCGTTGGAG ATCCTGGGCCTGGTGCTGTGCCTGGTGGGCTGGGGGGGTCTGATCCTGGCGTGCGGGCTGCCCATGTGG CAGGTGACCGCCTTCCTGGACCACAACATCGTGACGGCGCAGACCACCTGGAAGGGGCTGTGGATGTCG TGCGTGGTGCAGAGCACCGGGCACATGCAGTGCAAAGTGTACGACTCGGTGCTGGCTCTGAGCACCGAG GTGCAGGCGGCGCGGGCGCTCACCGTGAGCGCCGTGCTGCTGGCGTTCGTTGCGCTCTTCGTGACCCTG GCGGGCGCGCAGTGCACCACCTGCGTGGCCCCGGGCCCGGCCAAGGCGCGTGTGGCCCTCACGGGAGGC GTGCTCTACCTGTTTTGCGGGCTGCTGGCGCTCGTGCCACTCTGCTGGTTCGCCAACATTGTCGTCCGC GAGTTTTACGACCCGTCTGTGCCCGTGTCGCAGAAGTACGAGCTGGGCGCAGCGCTGTACATCGGCTGG GCGGCCACCGCGCTGCTCATGGTAGGCGGCTGCCTCTTGTGCTGCGGCGCCTGGGTCTGCACCGGCCGT CCCGACCTCAGCTTCCCCGTGAAGTACTCAGCGCCGCGGCGGCCCACGGCCACCGGCGACTACGACAAG AAGAACTACGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_003277 | 
| Insert Size | 912 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_003277.3 | 
| RefSeq Size | 1720 bp | 
| RefSeq ORF | 912 bp | 
| Locus ID | 7122 | 
| UniProt ID | O00501 | 
| Domains | PMP22_Claudin | 
| Protein Families | Transmembrane | 
| Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction | 
| MW | 31.6 kDa | 
| Gene Summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets. Mutations in this gene have been found in patients with velocardiofacial syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2018] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1, and encodes a protein (isoform 1) of 303 aa. A common SNP (rs885985) encodes a stop codon in the 5' coding region and thus, for some haplotypes, translation is predicted to initiate from a downstream AUG to produce a protein of 218 aa (isoform 2).  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC207122 | CLDN5 (Myc-DDK-tagged)-Human claudin 5 (CLDN5), transcript variant 2 | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 2400.00  | 
                                            |
| RC207122L1 | Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 2, Myc-DDK-tagged | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 4800.00  | 
                                            |
| RC207122L2 | Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 2, mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC207122L3 | Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 2, Myc-DDK-tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC207122L4 | Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 2, mGFP tagged | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 4800.00  | 
                                            |
| RC229148 | CLDN5 (Myc-DDK-tagged)-Human claudin 5 (CLDN5), transcript variant 2 | 
                                                     CNY 4465.00  | 
                                            |
| RG207122 | CLDN5 (tGFP-tagged) - Human claudin 5 (CLDN5), transcript variant 2 | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 4000.00  | 
                                            |
| SC118095 | CLDN5 (untagged)-Human claudin 5 (CLDN5), transcript variant 2 | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 2400.00  | 
                                            
其它Claudin 5产品
