PIGX (NM_017861) Human Untagged Clone

CAT#: SC327768

PIGX (untagged)-Human phosphatidylinositol glycan anchor biosynthesis class X (PIGX) transcript variant 2



  "NM_017861" in other vectors (5)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal anti-PIGX antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PIG-X
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_017861, the custom clone sequence may differ by one or more nucleotides


CTGGCGGCTCGGGTGGCGGCGGTTCGGGCGGCCGCCTGGCTGCTCCTCGGGGCGGCGACCGGGCTCACGC
GCGGGCCCGCCGCGGCCTTCACCGCCGCGCGCTCTGACGCCGGCATAAGGGCCATGTGTTCTGAAATTAT
TTTGAGGCAAGAAGTTTTGAAAGATGGTTTCCACAGAGACCTTTTAATCAAAGTGAAGTTTGGGGAAAGC
ATTGAGGACTTGCACACCTGCCGTCTCTTAATTAAACAGGACATTCCTGCAGGACTTTATGTGGATCCGT
ATGAGTTGGCTTCATTACGAGAGAGAAACATAACAGAGGCAGTGATGGTTTCAGAAAATTTTGATATAGA
GGCCCCTAACTATTTGTCCAAGGAGTCTGAAGTTCTCATTTATGCCAGACGAGATTCACAGTGCATTGAC
TGTTTTCAAGCCTTTTTGCCTGTGCACTGCCGCTATCATCGGCCGCACAGTGAAGATGGAGAAGCCTCGA
TTGTGGTCAATAACCCAGATTTGTTGATGTTTTGTGACCAAGAGTTCCCGATTTTGAAATGCTGGGCTCA
CTCAGAAGTGGCAGCCCCTTGTGCTTTGGAGAATGAGGATATCTGCCAATGGAACAAGATGAAGTATAAA
TCAGTATATAAGAATGTGATTCTACAAGTTCCAGTGGGACTGACTGTACATACCTCTCTAGTATGTTCTG
TGACTCTGCTCATTACAATCCTGTGCTCTACATTGATCCTTGTAGCAGTTTTCAAATATGGCCATTTTTC
CCTATAA


Restriction Sites SgfI-MluI     
ACCN NM_017861
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_017861.3, NP_060331.3
RefSeq Size 3052 bp
RefSeq ORF 777 bp
Locus ID 54965
UniProt ID Q8TBF5
Protein Families Transmembrane
Protein Pathways Glycosylphosphatidylinositol(GPI)-anchor biosynthesis, Metabolic pathways
Gene Summary This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...