APOPT1 (NM_032374) Human Untagged Clone
CAT＃: SC327755
APOPT1 (untagged)-Human chromosome 14 open reading frame 153 (C14orf153)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | APOP; APOP1; C14orf153 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC327755 representing NM_032374.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGCCGTGCGCCGCGGGAGCCAGGGGGCGTGGGGCCATGGTGGTCTTGCGGGCGGGGAAGAAGACC TTTCTCCCCCCTCTCTGCCGCGCCTTCGCCTGCCGCGGCTGTCAACTCGCTCCGGAGCGCGGCGCCGAG CGCAGGGATACGGCGCCCAGCGGGGTCTCAAGATTCTGCCCTCCAAGAAAGTCTTGCCATGATTGGATA GGACCCCCAGATAAATATTCAAACCTTCGACCTGTTCACTTTTACATACCTGAAAATGAATCTCCATTG GAACAAAAGCTTAGAAAATTAAGACAAGAAACACAAGAATGGAATCAACAGTTCTGGGCAAACCAGAAT TTGACTTTTAGTAAGGAAAAAGAAGAATTTATTCACTCAAGACTAAAAACTAAAGGCCTGGGCCTGAGA ACTGAATCAGGTCAGAAAGCAACATTGAATGCAGAAGAAATGGCGGACTTCTACAAGGAATTTTTAAGT AAAAATTTTCAGAAGCACATGTATTATAACAGAGATTGGTACAAGCGCAATTTTGCCATCACCTTCTTC ATGGGAAAAGTGGCCCTGGAAAGGATTTGGAACAAGCTTAAACAGAAACAAAAGAAGAGGAGCAACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_032374 |
| Insert Size | 621 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_032374.4 |
| RefSeq Size | 2528 bp |
| RefSeq ORF | 621 bp |
| Locus ID | 84334 |
| UniProt ID | Q96IL0 |
| Protein Families | Secreted Protein |
| MW | 24.2 kDa |
| Gene Summary | This gene encodes a protein that localizes to the mitochondria, where it stimulates the release of cytochrome c, thereby promoting programmed cell death. Mutations in this gene have been found in individuals with mitochondrial complex IV deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229120 | APOPT1 (Myc-DDK-tagged)-Human chromosome 14 open reading frame 153 (C14orf153) |
CNY 2400.00 |
|
| RC229120L3 | Lenti ORF clone of Human chromosome 14 open reading frame 153 (C14orf153), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC229120L4 | Lenti ORF clone of Human chromosome 14 open reading frame 153 (C14orf153), mGFP tagged |
CNY 5890.00 |
|
| RG229120 | APOPT1 (tGFP-tagged) - Human chromosome 14 open reading frame 153 (C14orf153) |
CNY 4370.00 |
|
| SC108011 | APOPT1 (untagged)-Human chromosome 14 open reading frame 153 (C14orf153) |
CNY 2400.00 |
