TIMM8B (NM_012459) Human Untagged Clone
CAT＃: SC327725
TIMM8B (untagged)-Human translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B) nuclear gene encoding mitochondrial protein transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DDP2; TIM8B |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC327725 representing NM_012459.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCGCAAACACAGCTGTCGGAAGGTGGCGAGCCTGAGGCGAACAATGGCGGAGCTGGGCGAAGCCGAT GAAGCGGAGTTGCAGCGCCTGGTGGCCGCCGAGCAGCAGAAGGCGCAGTTTACTGCACAGGTGCATCAC TTCATGGAGTTATGTTGGGATAAATGTGTGGAGAAGCCAGGGAATCGCCTAGACTCTCGCACTGAAAAT TGTCTCTCCAGCTGTGTAGACCGCTTCATTGACACCACTCTTGCCATCACCAGTCGGTTTGCCCAGATT GTACAGAAAGGAGGGCAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_012459 |
| Insert Size | 297 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_012459.2 |
| RefSeq Size | 823 bp |
| RefSeq ORF | 297 bp |
| Locus ID | 26521 |
| UniProt ID | Q9Y5J9 |
| Domains | zf-Tim10_DDP |
| MW | 11.2 kDa |
| Gene Summary | This gene encodes a member of a well-conserved family of proteins with similarity to yeast Tim mitochondrial import proteins. This gene is encoded by a nuclear gene and is transported into the intermembrane space of the mitochondrion. When formed into complexes, these proteins guide membrane-spanning proteins across the mitochondrial intermembrane space before they are added into the mitochondrial inner membrane. This gene is adjacent to succinate dehydrogenase, subunit D (SDHD), in which mutations have been found in affected members of families with hereditary paraganglioma.[provided by RefSeq, Aug 2009] Transcript Variant: This variant (1) encodes the functional protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. CCDS Note: The coding region has been updated to start at a downstream in-frame start codon that is supported by conservation data. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229090 | TIMM8B (Myc-DDK-tagged)-Human translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 1200.00 |
|
| RC229090L3 | Lenti ORF clone of Human translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC229090L4 | Lenti ORF clone of Human translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG229090 | TIMM8B (tGFP-tagged) - Human translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4370.00 |
|
| SC115362 | TIMM8B (untagged)-Human translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 1200.00 |
