PRKAR1B (NM_001164761) Human Untagged Clone

CAT#: SC327498

PRKAR1B (untagged)-Human protein kinase cAMP-dependent regulatory type I beta (PRKAR1B) transcript variant 1



  "NM_001164761" in other vectors (6)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
PRKAR1B (PKA regulatory subunit I beta) mouse monoclonal antibody, clone OTI2A3 (formerly 2A3)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PRKAR1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC327498 representing NM_001164761.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCTCCCCGCCCGCCTGCCCCTCGGAGGAGGACGAGAGCCTGAAGGGCTGTGAGCTGTACGTGCAG
CTGCACGGGATCCAGCAGGTCCTCAAAGACTGTATCGTCCACCTCTGCATCTCCAAGCCCGAACGCCCC
ATGAAGTTCCTCCGGGAGCACTTCGAGAAGCTGGAGAAGGAAGAAAACAGGCAGATTTTGGCGCGGCAA
AAGTCAAACTCACAGTCGGACTCCCATGATGAGGAGGTGTCGCCCACCCCCCCGAACCCTGTGGTGAAG
GCCCGCCGCCGGCGAGGAGGCGTGAGTGCCGAGGTGTACACCGAGGAGGACGCCGTGTCCTACGTCAGG
AAGGTGATTCCCAAGGACTACAAAACCATGACTGCGCTGGCCAAGGCCATCTCCAAGAACGTGCTCTTC
GCTCACCTGGATGACAACGAGAGGAGTGACATATTCGATGCCATGTTCCCTGTCACTCACATCGCTGGG
GAGACTGTTATACAGCAAGGGAATGAAGGAGACAACTTCTATGTCGTTGATCAAGGGGAAGTGGATGTG
TACGTGAACGGAGAGTGGGTGACCAACATCAGCGAGGGAGGCAGCTTCGGGGAGCTGGCGCTCATCTAC
GGCACCCCCAGGGCTGCGACCGTGAAAGCCAAGACGGACCTCAAGCTCTGGGGGATCGACCGGGACAGC
TACCGGCGCATCCTTATGGGCAGCACGCTGAGGAAACGCAAGATGTACGAGGAGTTCCTCAGCAAGGTC
TCCATCCTAGAGTCCCTGGAGAAGTGGGAGCGTCTGACCGTGGCGGATGCGCTGGAGCCCGTCCAGTTT
GAAGATGGAGAGAAAATTGTGGTCCAGGGAGAGCCTGGGGACGACTTTTACATCATCACGGAGGGCACC
GCGTCCGTGCTGCAGCGCCGGTCCCCCAATGAGGAGTACGTGGAGGTGGGGCGCCTGGGACCCTCTGAC
TACTTCGGGGAGATTGCACTGCTGCTGAACCGGCCCCGGGCGGCCACTGTCGTGGCCCGGGGGCCCCTC
AAGTGTGTGAAGCTGGACCGGCCCCGCTTCGAGCGTGTGCTGGGGCCCTGCTCTGAGATCCTCAAGAGG
AACATTCAGCGTTACAACAGCTTCATCTCCCTCACCGTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001164761
Insert Size 1146 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164761.1
RefSeq Size 2554 bp
RefSeq ORF 1146 bp
Locus ID 5575
UniProt ID P31321
Protein Families Druggable Genome
Protein Pathways Apoptosis, Insulin signaling pathway
MW 43.1 kDa
Gene Summary The protein encoded by this gene is a regulatory subunit of cyclic AMP-dependent protein kinase A (PKA), which is involved in the signaling pathway of the second messenger cAMP. Two regulatory and two catalytic subunits form the PKA holoenzyme, disbands after cAMP binding. The holoenzyme is involved in many cellular events, including ion transport, metabolism, and transcription. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (1) represents the longest transcript. All of the variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...