WDR51A (POC1A) (NM_001161581) Human Untagged Clone
CAT＃: SC327482
POC1A (untagged)-Human WD repeat domain 51A (WDR51A) transcript variant 3
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PIX2; SOFT; WDR51A |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001161581, the custom clone sequence may differ by one or more nucleotides
ATGGACTCATGCCTCATGGTCTGGCACATGAAGCCGCAGTCACGCGCCTACCGCTTCACT GGCCACAAGGATGCCGTCACCTGTGTGAACTTCTCTCCTTCGGGACACCTGCTTGCTTCC GGCTCCCGAGACAAGACTGTCCGCATCTGGGTACCCAATGTCAAAGGTGAGTCCACTGTG TTTCGTGCACACACAGCCACAGTGAGGAGTGTCCACTTCTGCAGTGATGGCCAGTCCTTC GTGACAGCCTCTGACGACAAGACAGTCAAAGTGTGGGCAACTCATCGCCAGAAATTCCTG TTCTCCCTGAGCCAGCATATCAACTGGGTCCGCTGTGCCAAGTTCTCCCCCGACGGGCGG CTCATCGTGTCTGCCAGTGATGACAAGACTGTTAAGCTGTGGGACAAGAGCAGCCGGGAA TGTGTCCACTCGTATTGTGAGCATGGCGGCTTTGTCACCTATGTGGACTTCCACCCCAGT GGGACGTGCATTGCCGCTGCCGGCATGGACAACACAGTGAAGGTGTGGGACGTGCGGACT CACCGGCTGCTGCAGCATTATCAGTTGCACAGTGCAGCAGTGAACGGGCTCTCTTTCCAC CCGTCGGGAAACTACCTGATCACAGCCTCCAGTGACTCAACCCTGAAGATCCTGGACCTG ATGGAGGGCCGGCTGCTCTACACACTCCACGGGCATCAGGGACCAGCCACCACTGTTGCC TTTTCAAGAACGGGGGAGTATTTTGCTTCTGGAGGCTCTGATGAACAAGTGATGGTTTGG AAGAGTAACTTTGATATTGTTGATCATGGAGAAGTCACGAAAGTGCCGAGGCCCCCAGCC ACACTGGCCAGCTCCATGGGGAATCTGCCAGAAGTGGACTTCCCTGTCCCCCCAGGCAGA GGCAGGAGTGTGGAGTCTGTGCAGAGCCAGCCCCAGGAGCCCGTGAGTGTGCCCCAGACA CTGACTAGCACGCTGGAGCACATTGTGGGCCAGCTGGATGTCCTCACTCAGACAGTCTCC ATTCTGGAGCAGCGGTTGACACTGACAGAAGACAAGCTGAAGCAGTGTCTGGAGAACCAG CAGCTAATCATGCAGAGAGCAACACCA |
| Restriction Sites | Please inquire |
| ACCN | NM_001161581 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001161581.1, NP_001155053.1 |
| RefSeq Size | 2284 bp |
| RefSeq ORF | 1110 bp |
| Locus ID | 25886 |
| UniProt ID | Q8NBT0 |
| Protein Families | Druggable Genome |
| Gene Summary | POC1 proteins contain an N-terminal WD40 domain and a C-terminal coiled coil domain and are part of centrosomes. They play an important role in basal body and cilia formation. This gene encodes one of the two POC1 proteins found in humans. Mutations in this gene result in short stature, onychodysplasia, facial dysmorphism, and hypotrichosis (SOFT) syndrome. [provided by RefSeq, Sep 2012] Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 1 and initiates translation at an in-frame downstream AUG. The encoded isoform (3) has a shorter N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228847 | POC1A (Myc-DDK-tagged)-Human POC1 centriolar protein homolog A (Chlamydomonas) (POC1A), transcript variant 3 |
CNY 4090.00 |
|
| RC228847L3 | Lenti-ORF clone of POC1A (Myc-DDK-tagged)-Human POC1 centriolar protein homolog A (Chlamydomonas) (POC1A), transcript variant 3 |
CNY 5990.00 |
|
| RC228847L4 | Lenti-ORF clone of POC1A (mGFP-tagged)-Human POC1 centriolar protein homolog A (Chlamydomonas) (POC1A), transcript variant 3 |
CNY 5990.00 |
|
| RG228847 | POC1A (tGFP-tagged) - Human POC1 centriolar protein homolog A (Chlamydomonas) (POC1A), transcript variant 3 |
CNY 4470.00 |
