LIMS2 (NM_001161403) Human Untagged Clone
CAT＃: SC327464
LIMS2 (untagged)-Human LIM and senescent cell antigen-like domains 2 (LIMS2) transcript variant 3
CNY 7220.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | LGMD2W; MDRCMTT; PINCH-2; PINCH2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001161403, the custom clone sequence may differ by one or more nucleotides
ATGACGGGAAGCAATATGTCGGACGCCTTGGCCAACGCCGTGTGCCAGCGCTGCCAGGCC CGCTTCTCCCCCGCCGAGCGCATTGTCAACAGCAATGGGGAGCTGTACCATGAGCACTGC TTCGTGTGTGCCCAGTGCTTCCGGCCCTTCCCCGAGGGGCTCTTCTATGAGTTTGAAGGC CGGAAGTACTGCGAACACGACTTCCAAATGCTGTTTGCTCCGTGCTGTGGATCCTGCGGT GAGTTCATCATTGGCCGCGTCATCAAGGCCATGAACAACAACTGGCACCCGGGCTGCTTC CGCTGCGAGCTGTGTGATGTGGAGCTGGCTGACCTGGGCTTTGTGAAGAATGCCGGCAGG CATCTCTGCCGGCCTTGCCACAACCGTGAGAAGGCCAAGGGCCTGGGCAAGTACATCTGC CAGCGGTGCCACCTGGTCATCGACGAGCAGCCCCTCATGTTCAGGAGCGACGCCTACCAC CCTGACCACTTCAACTGCACCCACTGTGGGAAGGAGCTGACAGCCGAGGCCCGCGAGCTG AAGGGTGAGCTCTACTGCCTGCCCTGCCATGACAAGATGGGCGTCCCCATCTGCGGGGCC TGCCGCCGGCCCATCGAGGGCCGAGTGGTCAACGCGCTGGGCAAGCAGTGGCACGTGGAG CACTTTGTCTGTGCCAAGTGTGAGAAGCCATTCCTGGGGCACCGGCACTATGAGAAGAAG GGCCTGGCCTACTGCGAGACTCACTACAACCAGCTCTTCGGGGACGTCTGCTACAACTGC AGCCATGTGATTGAAGGCGATGTGGTGTCGGCCCTCAACAAGGCCTGGTGTGTGAGCTGC TTCTCCTGCTCCACCTGCAACAGCAAGCTCACCCTGAAGAACAAGTTTGTGGAGTTCGAC ATGAAGCCCGTGTGTAAGAGGTGCTACGAGAAGTTCCCGCTGGAGCTGAAGAAGCGGCTG AAGAAGCTGTCGGAGCTGACCTCCCGCAAGGCCCAGCCCAAGGCCACAGACCTCAACTCT GCC |
| Restriction Sites | Please inquire |
| ACCN | NM_001161403 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001161403.1, NP_001154875.1 |
| RefSeq Size | 2062 bp |
| RefSeq ORF | 1026 bp |
| Locus ID | 55679 |
| UniProt ID | Q7Z4I7 |
| Gene Summary | This gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The encoded protein has five LIM domains, each domain forming two zinc fingers, which permit interactions which regulate cell shape and migration. A pseudogene of this gene is located on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (3) lacks an in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (3) is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228829 | LIMS2 (Myc-DDK-tagged)-Human LIM and senescent cell antigen-like domains 2 (LIMS2), transcript variant 3 |
CNY 3990.00 |
|
| RC228829L3 | Lenti-ORF clone of LIMS2 (Myc-DDK-tagged)-Human LIM and senescent cell antigen-like domains 2 (LIMS2), transcript variant 3 |
CNY 5890.00 |
|
| RC228829L4 | Lenti-ORF clone of LIMS2 (mGFP-tagged)-Human LIM and senescent cell antigen-like domains 2 (LIMS2), transcript variant 3 |
CNY 5890.00 |
|
| RG228829 | LIMS2 (tGFP-tagged) - Human LIM and senescent cell antigen-like domains 2 (LIMS2), transcript variant 3 |
CNY 4370.00 |
