MINDY1 (NM_001163260) Human Untagged Clone
CAT＃: SC327459
FAM63A (untagged)-Human family with sequence similarity 63 member A (FAM63A) transcript variant 5
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FAM63A; MINDY-1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001163260, the custom clone sequence may differ by one or more nucleotides
ATGAACATCCTCTTTCTTCAGTGGAAGGTGAAGCTCCCCCCGCAGAAGGAAGTGATCACA TCGGATGAGCTCATGGCCCATCTTGGAAACTGCCTCCTGTCCATCAAGCCCCAGGAGAAG TCAGAGGGACTTCAGCTTAATTTTCAGCAGAATGTGGATGATGCAATGACAGTGCTGCCT AAACTGGCCACAGGTCTGGATGTCAATGTGCGATTCACAGGCGTCTCTGATTTTGAGTAT ACACCCGAGTGCAGTGTCTTTGACCTGCTAGGCATACCTCTGTACCATGGCTGGCTTGTT GATCCACAGAGTCCTGAGGCTGTGCGTGCAGTTGGGAAACTGAGTTACAACCAGCTGGTG GAGAGGATCATCACCTGCAAACACTCCAGTGACACCAACCTCGTGACAGAAGGCCTGATT GCAGAGCAGTTCCTGGAGACCACCGCGGCCCAGCTGACCTACCACGGACTGTGTGAGCTG ACAGCAGCTGCTAAGGAGGGTGAACTTAGCGTCTTTTTCCGAAACAACCACTTTAGCACC ATGACTAAGCATAAGAGTCACTTATACCTACTGGTCACTGACCAGGGCTTTCTACAGGAG GAGCAAGTCGTATGGGAGAGCCTGCACAATGTGGATGGAGACAGCTGCTTTTGTGACTCT GACTTTCACCTGAGTCATTCCCTGGGCAAGGGGCCTGGAGCAGAAGGTGGGAGTGGCTCC CCAGAAAAGCAGCTGCAGGTAGACCAGGACTACCTGATTGCTCTGTCCCTGCAGCAGCAA CAGCCACGAGGCCCGCTGGGGCTTACCGACTTGGAGCTGGCCCAGCAGCTTCAGCAAGAG GAGTATCAACAGCAGCAGGCAGCGCAGCCAGTGCGGATGCGGACGCGGGTCCTGTCACTG CAGGGGAGAGGAGCCACATCTGGACGCCCAGCCGGGGAGCGTCGGCAGAGGCCGAAGCAC GAGTCAGACTGCATTCTGCTG |
| Restriction Sites | Please inquire |
| ACCN | NM_001163260 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001163260.1, NP_001156732.1 |
| RefSeq Size | 2063 bp |
| RefSeq ORF | 984 bp |
| Locus ID | 55793 |
| UniProt ID | Q8N5J2 |
| Gene Summary | Hydrolase that can specifically remove 'Lys-48'-linked conjugated ubiquitin from proteins. Has exodeubiquitinase activity and has a preference for long polyubiquitin chains. May play a regulatory role at the level of protein turnover.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) uses an alternate splice site in the 5' coding region and a downstream start codon, compared to variant 1. The promoter and extent of the 5' UTR for this variant have not been characterized. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Both variants 2 and 5 encode the same isoform. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228824 | FAM63A (Myc-DDK-tagged)-Human family with sequence similarity 63, member A (FAM63A), transcript variant 5 |
CNY 4660.00 |
|
| RC228824L3 | Lenti-ORF clone of FAM63A (Myc-DDK-tagged)-Human family with sequence similarity 63, member A (FAM63A), transcript variant 5 |
CNY 6560.00 |
|
| RC228824L4 | Lenti-ORF clone of FAM63A (mGFP-tagged)-Human family with sequence similarity 63, member A (FAM63A), transcript variant 5 |
CNY 6560.00 |
|
| RG228824 | FAM63A (tGFP-tagged) - Human family with sequence similarity 63, member A (FAM63A), transcript variant 5 |
CNY 5130.00 |
