TNIP2 (NM_001161527) Human Untagged Clone
CAT＃: SC327456
TNIP2 (untagged)-Human TNFAIP3 interacting protein 2 (TNIP2) transcript variant 2
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ABIN2; FLIP1; KLIP |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001161527, the custom clone sequence may differ by one or more nucleotides
ATGCAGCAGCTGCTGAGCCAGCCCCAACACGAGCGAGAGAAGGAAGTCGTCCTGCTACGG AGGAGCATGGCAGAAGGGGAGCGCGCCCGGGCCGCCAGTGACGTCCTGTGCCGCTCCTTG GCCAACGAGACCCATCAGCTGCGGAGGACGCTGACCGCCACCGCCCACATGTGTCAGCAT CTGGCCAAGTGTCTGGATGAACGACAGCATGCACAAAGGAATGTGGGGGAGAGAAGTCCT GACCAGTCGGAACACACAGATGGGCACACCTCTGTCCAGAGTGTTATTGAGAAGTTGCAG GAAGAAAATCGACTGTTAAAACAGAAGGTGACTCACGTTGAAGACCTCAATGCCAAGTGG CAGCGCTACAACGCCAGCAGGGACGAATACGTGAGGGGGCTCCATGCGCAGCTCAGGGGG CTGCAGATCCCCCACGAGCCCGAGCTGATGAGGAAGGAGATCTCCCGGCTCAACAGACAG TTGGAAGAGAAAATAAATGACTGTGCCGAAGTGAAGCAGGAGCTGGCGGCCTCCAGGACG GCCCGGGATGCTGCGTTGGAGCGGGTGCAGATGCTGGAACAGCAGATTCTCGCTTACAAG GATGACTTCATGTCAGAAAGGGCCGATCGGGAACGGGCTCAAAGTAGGATTCAAGAACTG GAGGAAAAGGTCGCCTCTTTGCTGCACCAGGTGTCCTGGAGACAGGATTCTCGAGAGCCA GACGCCGGCCGGATTCACGCTGGGAGCAAAACTGCCAAGTATTTGGCCGCCGACGCATTA GAGCTTATGGTGCCTGGTGGCTGGAGGCCTGGGACTGGGTCCCAGCAGCCAGAACCCCCT GCAGAGGGCGGGCATCCTGGCGCGGCCCAGAGAGGCCAGGGGGACCTTCAGTGCCCTCAC TGCCTGCAGTGCTTCAGTGACGAGCAAGGGGAAGAGCTCCTCAGGCATGTGGCTGAGTGC TGCCAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001161527 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001161527.1, NP_001154999.1 |
| RefSeq Size | 1707 bp |
| RefSeq ORF | 969 bp |
| Locus ID | 79155 |
| UniProt ID | Q8NFZ5 |
| Gene Summary | This gene encodes a protein which acts as an inhibitor of NFkappaB activation. The encoded protein is also involved in MAP/ERK signaling pathway in specific cell types. It may be involved in apoptosis of endothelial cells. Alternative splicing results in multiple transcript variants. A pseudogene related to this gene is located on the X chromosome.[provided by RefSeq, May 2014] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228821 | TNIP2 (Myc-DDK-tagged)-Human TNFAIP3 interacting protein 2 (TNIP2), transcript variant 2 |
CNY 3990.00 |
|
| RC228821L3 | Lenti-ORF clone of TNIP2 (Myc-DDK-tagged)-Human TNFAIP3 interacting protein 2 (TNIP2), transcript variant 2 |
CNY 5890.00 |
|
| RC228821L4 | Lenti-ORF clone of TNIP2 (mGFP-tagged)-Human TNFAIP3 interacting protein 2 (TNIP2), transcript variant 2 |
CNY 5890.00 |
|
| RG228821 | TNIP2 (tGFP-tagged) - Human TNFAIP3 interacting protein 2 (TNIP2), transcript variant 2 |
CNY 4370.00 |
