Syntaxin 1a (STX1A) (NM_001165903) Human Untagged Clone
CAT#: SC327419
STX1A (untagged)-Human syntaxin 1A (brain) (STX1A) transcript variant 2
CNY 3990.00
Product images

CNY 1999.00
CNY 3490.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HPC-1; P35-1; STX1; SYN1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327419 representing NM_001165903.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGGACCGAACCCAGGAGCTCCGCACGGCCAAGGACAGCGATGATGATGATGATGTCGCTGTCACC GTGGACCGAGACCGCTTCATGGATGAGTTCTTTGAGCAGGTGGAGGAGATTCGAGGCTTCATTGACAAG ATCGCAGAGAACGTGGAGGAGGTGAAGCGGAAGCACAGTGCCATCCTGGCATCCCCCAACCCCGATGAG AAGACGAAGGAGGAGCTGGAAGAACTCATGTCCGACATAAAGAAGACAGCAAACAAAGTTCGTTCCAAG TTAAAGAGCATCGAGCAGTCCATCGAGCAAGAGGAAGGCCTGAACCGCTCCTCCGCTGACCTGAGGATC CGGAAGACACAGCACTCCACGCTGTCCAGAAAGTTTGTGGAGGTCATGTCGGAGTACAACGCCACGCAG TCCGACTACCGCGAGCGCTGCAAAGGCCGCATCCAGAGGCAGCTGGAGATCACCGGCAGGACCACGACC AGTGAGGAGCTGGAGGACATGCTGGAGAGTGGGAACCCCGCCATCTTTGCCTCTGGGATCATCATGGAC TCCAGCATCTCGAAGCAGGCTCTGAGCGAGATTGAGACGCGGCACAGTGAGATCATCAAGCTGGAGAAC AGCATCCGTGAGCTACACGACATGTTCATGGACATGGCCATGCTCGTGGAGAGCCAGACTATGTGGAGA GGGCCGTGTCTGACACCAAGAAGGCCGTCAAGTACCAGAGCAAGGCGCGCCGGAAGAAAATCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001165903 |
Insert Size | 756 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001165903.1 |
RefSeq Size | 2092 bp |
RefSeq ORF | 756 bp |
Locus ID | 6804 |
UniProt ID | Q16623 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | SNARE interactions in vesicular transport |
MW | 29 kDa |
Gene Summary | This gene encodes a member of the syntaxin superfamily. Syntaxins are nervous system-specific proteins implicated in the docking of synaptic vesicles with the presynaptic plasma membrane. Syntaxins possess a single C-terminal transmembrane domain, a SNARE [Soluble NSF (N-ethylmaleimide-sensitive fusion protein)-Attachment protein REceptor] domain (known as H3), and an N-terminal regulatory domain (Habc). Syntaxins bind synaptotagmin in a calcium-dependent fashion and interact with voltage dependent calcium and potassium channels via the C-terminal H3 domain. This gene product is a key molecule in ion channel regulation and synaptic exocytosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) lacks an internal segment in the 3' coding region, as compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228784 | STX1A (Myc-DDK-tagged)-Human syntaxin 1A (brain) (STX1A), transcript variant 2 |
CNY 2400.00 |
|
RC228784L1 | Lenti ORF clone of Human syntaxin 1A (brain) (STX1A), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC228784L2 | Lenti ORF clone of Human syntaxin 1A (brain) (STX1A), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC228784L3 | Lenti ORF clone of Human syntaxin 1A (brain) (STX1A), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC228784L4 | Lenti ORF clone of Human syntaxin 1A (brain) (STX1A), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG228784 | STX1A (tGFP-tagged) - Human syntaxin 1A (brain) (STX1A), transcript variant 2 |
CNY 4370.00 |
其它Syntaxin 1a产品