MAFF (NM_001161574) Human Untagged Clone
CAT#: SC327368
MAFF (untagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF) transcript variant 5
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hMafF; U-MAF |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001161574, the custom clone sequence may differ by one or more nucleotides
ATGGGGCTGTCGGTGCGCGAGCTGAACCGGCATCTGCGCGGGCTCTCCGCCGAGGAGGTG ACACGGCTCAAGCAGCGGCGCCGCACACTCAAAAACCGTGGCTACGCCGCCAGCTGCCGC GTGAAGCGCGTGTGCCAGAAGGAGGAGCTGCAGAAGCAGAAGTCGGAGCTGGAGCGCGAG GTGGACAAGCTGGCGCGCGAGAACGCCGCCATGCGCCTGGAGCTCGACGCGCTGCGCGGC AAGTGCGAGGCGCTGCAGGGCTTCGCGCGCTCCGTGGCCGCCGCCCGCGGGCCCGCCACG CTCGTGGCGCCGGCCAGCGTCATCACCATCGTCAAGTCCACCCCGGGCTCGGGGTCTGGC CCCGCCCACGGCCCGGACCCCGCCCACGGCCCGGCCTCCTGCTCC |
Restriction Sites | Please inquire |
ACCN | NM_001161574 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001161574.1, NP_001155046.1 |
RefSeq Size | 2383 bp |
RefSeq ORF | 408 bp |
Locus ID | 23764 |
UniProt ID | Q9ULX9 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | The protein encoded by this gene is a basic leucine zipper (bZIP) transcription factor that lacks a transactivation domain. It is known to bind the US-2 DNA element in the promoter of the oxytocin receptor (OTR) gene and most likely heterodimerizes with other leucine zipper-containing proteins to enhance expression of the OTR gene during term pregnancy. The encoded protein can also form homodimers, and since it lacks a transactivation domain, the homodimer may act as a repressor of transcription. This gene may also be involved in the cellular stress response. Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2009] Transcript Variant: This variant (5) lacks the exon containing the translation start site compared to variant 3. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228733 | MAFF (Myc-DDK-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), transcript variant 5 |
CNY 3990.00 |
|
RC228733L3 | Lenti-ORF clone of MAFF (Myc-DDK-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), transcript variant 5 |
CNY 5890.00 |
|
RC228733L4 | Lenti-ORF clone of MAFF (mGFP-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), transcript variant 5 |
CNY 5890.00 |
|
RG228733 | MAFF (tGFP-tagged) - Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), transcript variant 5 |
CNY 4370.00 |