FXYD6 (NM_001164837) Human Untagged Clone
CAT#: SC327358
FXYD6 (untagged)-Human FXYD domain containing ion transport regulator 6 (FXYD6) transcript variant 5
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164837, the custom clone sequence may differ by one or more nucleotides
ATGGAGTTGGTGCTGGTCTTCCTCTGCAGCCTGCTGGCCCCCATGGTCCTGGCCAGTGCA GCTGAAAAGGAGAAGGAAATGGACCCTTTTCATTATGATTACCAGACCCTGAGGATTGGG GGACTGGTGTTCGCTGTGGTCCTCTTCTCGGTTGGGATCCTCCTTATCCTAAGTCGCAGG TGCAAGTGCAGTTTCAATCAGAAGCCCCGGGCCCCAGGAGATGAGGAAGCCCAGGTGGAG AACCTCATCACCGCCAATGCAACAGAGCCCCAGAAAGCAGAGAAC |
Restriction Sites | Please inquire |
ACCN | NM_001164837 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001164837.1, NP_001158309.1 |
RefSeq Size | 2133 bp |
RefSeq ORF | 288 bp |
Locus ID | 53826 |
UniProt ID | Q9H0Q3 |
Protein Families | Ion Channels: Other, Transmembrane |
Gene Summary | This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes phosphohippolin, which likely affects the activity of Na,K-ATPase. Multiple alternatively spliced transcript variants encoding the same protein have been described. Related pseudogenes have been identified on chromosomes 10 and X. Read-through transcripts have been observed between this locus and the downstream sodium/potassium-transporting ATPase subunit gamma (FXYD2, GeneID 486) locus.[provided by RefSeq, Feb 2011] Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 1. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228723 | FXYD6 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 6 (FXYD6), transcript variant 5 |
CNY 1,200.00 |
|
RC228723L3 | Lenti-ORF clone of FXYD6 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 6 (FXYD6), transcript variant 5 |
CNY 5,890.00 |
|
RC228723L4 | Lenti-ORF clone of FXYD6 (mGFP-tagged)-Human FXYD domain containing ion transport regulator 6 (FXYD6), transcript variant 5 |
CNY 5,890.00 |
|
RG228723 | FXYD6 (tGFP-tagged) - Human FXYD domain containing ion transport regulator 6 (FXYD6), transcript variant 5 |
CNY 4,370.00 |