SMIM12 (NM_001164824) Human Untagged Clone
CAT#: SC327353
SMIM12 (untagged)-Human chromosome 1 open reading frame 212 (C1orf212) transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C1orf212 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001164824, the custom clone sequence may differ by one or more nucleotides
ATGTGGCCTGTGTTTTGGACCGTGGTTCGTACCTATGCTCCTTATGTCACATTCCCTGTT GCCTTCGTGGTCGGGGCTGTGGGTTACCACCTGGAATGGTTCATCAGGGGAAAGGACCCC CAGCCCGTGGAGGAGGAAAAGAGCATCTCAGAGCGCCGGGAGGATCGCAAGCTGGATGAG CTTCTAGGCAAGGACCACACGCAGGTGGTGAGCCTTAAGGACAAGCTAGAATTTGCCCCG AAAGCTGTGCTGAACAGAAACCGCCCAGAGAAGAAT |
Restriction Sites | Please inquire |
ACCN | NM_001164824 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001164824.1, NP_001158296.1 |
RefSeq Size | 6021 bp |
RefSeq ORF | 279 bp |
Locus ID | 113444 |
UniProt ID | Q96EX1 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228718 | SMIM12 (Myc-DDK-tagged)-Human chromosome 1 open reading frame 212 (C1orf212), transcript variant 1 |
CNY 1200.00 |
|
RC228718L3 | Lenti-ORF clone of SMIM12 (Myc-DDK-tagged)-Human chromosome 1 open reading frame 212 (C1orf212), transcript variant 1 |
CNY 5890.00 |
|
RC228718L4 | Lenti-ORF clone of SMIM12 (mGFP-tagged)-Human chromosome 1 open reading frame 212 (C1orf212), transcript variant 1 |
CNY 5890.00 |
|
RG228718 | SMIM12 (tGFP-tagged) - Human chromosome 1 open reading frame 212 (C1orf212), transcript variant 1 |
CNY 4370.00 |