MTF2 (NM_001164393) Human Untagged Clone

CAT#: SC327042

MTF2 (untagged)-Human metal response element binding transcription factor 2 (MTF2) transcript variant 4



  "NM_001164393" in other vectors (4)

CNY 7890.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-MTF2 Antibody
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ976O13.2; M96; PCL2; TDRD19A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001164393, the custom clone sequence may differ by one or more nucleotides
ATGGTCTGTACAATATGTCAAGAAGAGTATTCAGAAGCTCCCAATGAAATGGTTATATGT
GACAAGTGTGGCCAAGGATATCATCAGTTGTGTCACACACCTCATATTGATTCCAGTGTG
ATTGATTCAGATGAAAAATGGCTCTGTCGGCAGTGTGTTTTTGCAACAACAACAAAGAGG
GGTGGTGCACTTAAGAAAGGACCAAATGCCAAAGCATTGCAAGTCATGAAGCAGACATTA
CCCTATAGTGTGGCAGACCTTGAATGGGATGCAGGTCATAAAACCAATGTCCAGCAGTGT
TACTGCTATTGTGGAGGCCCTGGAGACTGGTATTTGAAGATGCTACAGTGCTGCAAATGT
AAGCAGTGGTTTCATGAGGCTTGTGTGCAATGCCTTCAAAAGCCAATGCTATTTGGAGAC
AGATTTTATACGTTTATATGCTCTGTCTGCAGTTCTGGACCAGAATACCTCAAACGTCTA
CCATTACAGTGGGTAGATATAGCACACCTATGCCTTTACAACCTAAGTGTTATTCATAAG
AAGAAATACTTTGATTCTGAACTTGAGCTTATGACATACATTAATGAAAACTGGGATAGA
TTGCACCCTGGAGAGCTGGCAGACACACCAAAATCTGAAAGATATGAGCATGTTCTGGAG
GCATTAAATGATTACAAGACCATGTTTATGTCTGGGAAAGAAATAAAGAAGAAGAAGCAT
TTGTTTGGGTTGCGAATTCGTGTTCCTCCTGTGCCACCAAATGTGGCTTTCAAAGCAGAG
AAAGAACCTGAAGGAACATCTCATGAATTTAAAATTAAAGGCAGAAAGGCATCCAAACCT
ATATCTGATTCAAGGGAAGTAAGCAATGGCATAGAAAAAAAAGGAAAGAAAAAATCTGTA
GGTCGTCCACCTGGCCCATATACAAGAAAAATGATTCAAAAAACTGCTGAGCCACTTTTG
GATAAGGAATCAATTTCAGAGAATCCTACTTTGGATTTACCTTGTTCTATAGGGAGAACT
GAGGGAACTGCACATTCATCCAATACCTCAGATGTGGATTTCACGGGTGCTTCCAGTGCA
AAAGAAACTACCTCGTCTAGCATTTCCAGGCATTATGGATTATCTGACTCCAGAAAAAGA
ACGCGTACAGGAAGATCTTGGCCTGCTGCAATACCACATTTGCGGAGAAGAAGAGGTCGT
CTTCCAAGAAGAGCACTCCAGACTCAGAACTCAGAAATTGTAAAAGATGATGAAGGCAAA
GAAGATTATCAGTTTGATGAACTCAACACAGAGATTCTGAATAACTTAGCAGATCAGGAG
TTACAACTCAATCATCTAAAGAACTCCATTACCAGTTATTTTGGTGCTGCAGGTAGAATA
GCATGTGGCGAAAAATACCGAGTTTTGGCACGTCGGGTGACACTTGATGGAAAGGTGCAG
TATCTTGTGGAATGGGAAGGAGCAACTGCATCC
Restriction Sites Please inquire     
ACCN NM_001164393
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164393.1, NP_001157865.1
RefSeq Size 3863 bp
RefSeq ORF 1476 bp
Locus ID 22823
UniProt ID Q9Y483
Protein Families Druggable Genome, Transcription Factors
Gene Summary Polycomb group (PcG) that specifically binds histone H3 trimethylated at 'Lys-36' (H3K36me3) and recruits the PRC2 complex. Acts by binding to H3K36me3, a mark for transcriptional activation, and recruiting the PRC2 complex, leading to enhance PRC2 H3K27me3 methylation activity. Regulates the transcriptional networks during embryonic stem cell self-renewal and differentiation. Promotes recruitment of the PRC2 complex to the inactive X chromosome in differentiating XX ES cells and PRC2 recruitment to target genes in undifferentiated ES cells. Required to repress Hox genes by enhancing H3K27me3 methylation of the PRC2 complex. In some conditions may act as an inhibitor of PRC2 activity: able to activate the CDKN2A gene and promote cellular senescence by suppressing the catalytic activity of the PRC2 complex locally. Binds to the metal-regulating-element (MRE) of MT1A gene promoter (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks two coding exons compared to variant 1, that causes a frameshift. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...