IGF2BP1 (NM_001160423) Human Untagged Clone
CAT＃: SC326984
IGF2BP1 (untagged)-Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1) transcript variant 2
CNY 7030.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CRD-BP; CRDBP; IMP-1; IMP1; VICKZ1; ZBP1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326984 representing NM_001160423.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACAAGCTTTACATCGGCAACCTCAACGAGAGCGTGACCCCCGCGGACTTGGAGAAAGTGTTTGCG GAGCACAAGATCTCCTACAGCGGCCAGTTCTTGGTCAAATCCGGCTACGCCTTCGTGGACTGCCCGGAC GAGCACTGGGCGATGAAGGCCATCGAAACTTTCTCCGGGAAAGTAGAATTACAAGGAAAACGCTTAGAG ATTGAACATTCGGTGCCCAAAAAACAAAGGAGCCGGAAAATTCAAATCCGAAATATTCCACCCCAGCTC CGATGGGAAGTACTGGACAGCCTGCTGGCTCAGTATGGTACAGTAGAGAACTGTGAGCAAGTGAACACC GAGAGTGAGACGGCAGTGGTGAATGTCACCTATTCCAACCGGGAGCAGACCAGGCAGGCTGACGAGGTT CCCCTGAAGATCCTGGCCCATAATAACTTTGTAGGGCGTCTCATTGGCAAGGAAGGACGGAACCTGAAG AAGGTAGAGCAAGATACCGAGACAAAAATCACCATCTCCTCGTTGCAAGACCTTACCCTTTACAACCCT GAGAGGACCATCACTGTGAAGGGGGCCATCGAGAATTGTTGCAGGGCCGAGCAGGAAATAATGAAGAAA GTTCGGGAGGCCTATGAGAATGATGTGGCTGCCATGAGCCTGCAGTCTCACCTGATCCCTGGCCTGAAC CTGGCTGCTGTAGGTCTTTTCCCAGCTTCATCCAGCGCAGTCCCGCCGCCTCCCAGCAGCGTTACTGGG GCTGCTCCCTATAGCTCCTTTATGCAGGCTCCCGAGCAGGAGATGGTGCAGGTGTTTATCCCCGCCCAG GCAGTGGGCGCCATCATCGGCAAGAAGGGGCAGCACATCAAACAGCTCTCCCGGTTTGCCAGCGCCTCC ATCAAGATTGCACCACCCGAAACACCTGACTCCAAAGTTCGTATGGTTATCATCACTGGACCGCCAGAG GCCCAATTCAAGGCTCAGGGAAGAATCTATGGCAAACTCAAGGAGGAGAACTTCTTTGGTCCCAAGGAG GAAGTGAAGCTGGAGACCCACATACGTGTGCCAGCATCAGCAGCTGGCCGGGTCATTGGCAAAGGTGGA AAAACGGTGAACGAGTTGCAGAATTTGACGGCAGCTGAGGTGGTAGTACCAAGAGACCAGACCCCTGAT GAGAACGACCAGGTCATCGTGAAAATCATCGGACATTTCTATGCCAGTCAGATGGCTCAACGGAAGATC CGAGACATCCTGGCCCAGGTTAAGCAGCAGCATCAGAAGGGACAGAGTAACCAGGCCCAGGCACGGAGG AAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001160423 |
| Insert Size | 1317 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001160423.1 |
| RefSeq Size | 8352 bp |
| RefSeq ORF | 1317 bp |
| Locus ID | 10642 |
| UniProt ID | Q9NZI8 |
| MW | 48.6 kDa |
| Gene Summary | This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009] Transcript Variant: This variant (2) lacks two alternate in-frame exons compared to variant 1. The resulting isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228349 | IGF2BP1 (Myc-DDK-tagged)-Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2 |
CNY 5488.00 |
|
| RC228349L1 | Lenti ORF clone of Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2, Myc-DDK-tagged |
CNY 7888.00 |
|
| RC228349L2 | Lenti ORF clone of Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RC228349L3 | Lenti ORF clone of Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC228349L4 | Lenti ORF clone of Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG228349 | IGF2BP1 (tGFP-tagged) - Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 2 |
CNY 7088.00 |
其它IGF2BP1产品
