NEK6 (NM_001166169) Human Untagged Clone
CAT＃: SC326904
NEK6 (untagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6) transcript variant 4
CNY 5510.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SID6-1512 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001166169, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCCACTGGATGGGATTCTAGATGCTCGCCTGGGACCCAGGTTCGTGCCCTCGTG AGGCTGGCATGCAGGATGGCAGGACAGCCCGGCCACATGCCCCATGGAGGGAGTTCCAAC AACCTCTGCCACACCCTGGGGCCTGTGCATCCTCCTGACCCACAGAGGCATCCCAACACG CTGTCTTTTCGCTGCTCGCTGGCGGACTTCCAGATCGAAAAGAAGATAGGCCGAGGACAG TTCAGCGAGGTGTACAAGGCCACCTGCCTGCTGGACAGGAAGACAGTGGCTCTGAAGAAG GTGCAGATCTTTGAGATGATGGACGCCAAGGCGAGGCAGGACTGTGTCAAGGAGATCGGC CTCTTGAAGCAACTGAACCACCCAAATATCATCAAGTATTTGGACTCGTTTATCGAAGAC AACGAGCTGAACATTGTGCTGGAGTTGGCTGACGCAGGGGACCTCTCGCAGATGATCAAG TACTTTAAGAAGCAGAAGCGGCTCATCCCGGAGAGGACAGTATGGAAGTACTTTGTGCAG CTGTGCAGCGCCGTGGAGCACATGCATTCACGCCGGGTGATGCACCGAGACATCAAGCCT GCCAACGTGTTCATCACAGCCACGGGCGTCGTGAAGCTCGGTGACCTTGGTCTGGGCCGC TTCTTCAGCTCTGAGACCACCGCAGCCCACTCCCTAGTGGGGACGCCCTACTACATGTCA CCGGAGAGGATCCATGAGAACGGCTACAACTTCAAGTCCGACATCTGGTCCCTGGGCTGT CTGCTGTACGAGATGGCAGCCCTCCAGAGCCCCTTCTATGGAGATAAGATGAATCTCTTC TCCCTGTGCCAGAAGATCGAGCAGTGTGACTACCCCCCACTCCCCGGGGAGCACTACTCC GAGAAGTTACGAGAACTGGTCAGCATGTGCATCTGCCCTGACCCCCACCAGAGACCTGAC ATCGGATACGTGCACCAGGTGGCCAAGCAGATGCACATCTGGATGTCCAGCACC |
| Restriction Sites | Please inquire |
| ACCN | NM_001166169 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001166169.1, NP_001159641.1 |
| RefSeq Size | 2596 bp |
| RefSeq ORF | 1017 bp |
| Locus ID | 10783 |
| UniProt ID | Q9HC98 |
| Protein Families | Druggable Genome, Protein Kinase |
| Gene Summary | The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228269 | NEK6 (Myc-DDK-tagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 4 |
CNY 3656.00 |
|
| RC228269L3 | Lenti-ORF clone of NEK6 (Myc-DDK-tagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 4 |
CNY 5890.00 |
|
| RC228269L4 | Lenti-ORF clone of NEK6 (mGFP-tagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 4 |
CNY 5890.00 |
|
| RG228269 | NEK6 (tGFP-tagged) - Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 4 |
CNY 4370.00 |
