TMEM64 (NM_001146273) Human Untagged Clone
CAT#: SC326891
TMEM64 (untagged)-Human transmembrane protein 64 (TMEM64) transcript variant 2
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326891 representing NM_001146273.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCGGAGCCCGGGCGGGATCCTGCTCCAGGCGCTGCCCCGGCTGCTGCAGCACGCCGCCCTCCCGGGC CTCGCCGAGCTGCCGGCCCGCTGGGCCCTGCCGCGGGGTGCGGGCGGGGACGGCCCGGCGGACCGCCTT CCCCGCGGGGGCGGGGCGAGCGCGGCGGCGGCAGCAGCGGCGGCCTCGGGCGCCCTGCTCGGCGCCTAT CTGGAGCGCCACGGTCCGCCCGAGGCTTCGGAGCTGCCGGAGCCGGGCGGGGCCTTGGCGGGCGGCCCC GGGAGTGGCGGCGGCGGCGTGGTGGTCGGCGTGGCTGAGGTGAGAAACTGGCGCTGCTGCTGCCTCGGC AGCACCTGTTGGTGCCGGAGCCTCGTGCTGGTCTGCGTGTTGGCCGCCCTGTGCTTCGCTTCCCTGGCC CTGGTCCGCCGCTACCTTCACCACCTCCTGCTGTGGGTGGAGAGCCTTGACTCGCTGCTGGGGGTCCTG CTCTTCGTCGTGGGCTTCATCGTGGTCTCTTTCCCCTGCGGCTGGGGCTACATCGTGCTCAACGTGGCC GCTGGCTACCTGTACGGCTTCGTGCTGGGCATGGGTCTGATGATGGTGGGCGTCCTCATCGGCACCTTC ATCGCCCATGTGGTCTGCAAGCGGCTCCTCACCGCCTGGGTGGCCGCCAGGATCCAGAGCAGCGAGAAG CTGAGCGCGGTTATTCGCGTAGTGGAGGGAGGAAGCGGCCTGAAAGTGGTGGCGCTGGCCAGACTGACA CCCATACCTTTTGGGCTTCAGAATGCAGTGTTTTCGATTATTATAAGTATAGGCCTCATGTTTTATGTA GTTCATCGAGCTCAAGTGGAATTGAATGCAGCTATTGTAGCTTGTGAAATGGAACTGAAATCTTCTCTG GTTAAAGGCAATCAACCAAATACCAGTGGCTCTTCATTCTACAACAAGAGGACCCTAACATTTTCTGGA GGTGGAATCAATGTTGTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001146273 |
Insert Size | 987 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001146273.1 |
RefSeq Size | 4663 bp |
RefSeq ORF | 987 bp |
Locus ID | 169200 |
UniProt ID | Q6YI46 |
Protein Families | Transmembrane |
MW | 34 kDa |
Gene Summary | Positively regulates TNFSF11-induced osteoclast differentiation. Acts as a regulator of TNFSF11-mediated Ca(2+) signaling pathways via its interaction with SERCA2 which is critical for the TNFSF11-induced CREB1 activation and mitochondrial ROS generation necessary for proper osteoclast generation. Association between TMEM64 and SERCA2 in the ER leads to cytosolic Ca (2+) spiking for activation of NFATC1 and production of mitochondrial ROS, thereby triggering Ca (2+) signaling cascades that promote osteoclast differentiation and activation. Negatively regulates osteoblast differentiation and positively regulates adipocyte differentiation via modulation of the canonical Wnt signaling pathway. Mediates the switch in lineage commitment to osteogenesis rather than to adipogenesis in mesenchymal stem cells by negatively regulating the expression, activity and nuclear localization of CTNNB1.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228256 | TMEM64 (Myc-DDK-tagged)-Human transmembrane protein 64 (TMEM64), transcript variant 2 |
CNY 2400.00 |
|
RC228256L1 | Lenti ORF clone of Human transmembrane protein 64 (TMEM64), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC228256L2 | Lenti ORF clone of Human transmembrane protein 64 (TMEM64), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC228256L3 | Lenti ORF clone of Human transmembrane protein 64 (TMEM64), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC228256L4 | Lenti ORF clone of Human transmembrane protein 64 (TMEM64), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG228256 | TMEM64 (tGFP-tagged) - Human transmembrane protein 64 (TMEM64), transcript variant 2 |
CNY 4370.00 |