LYK5 (STRADA) (NM_001165969) Human Untagged Clone
CAT#: SC326883
STRADA (untagged)-Human STE20-related kinase adaptor alpha (STRADA) transcript variant 5
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LYK5; NY-BR-96; PMSE; Stlk; STRAD; STRAD alpha |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326883 representing NM_001165969.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCATTTCTTGTAAGTAAACCAGAGCGAATCAGGACCAATGATGCGAGCTCAGAGTCAATAGCATCC TTCTCTAAACAGGAGGTCATGAGTAGCTTTCTGCCAGAGGGAGGGTGTTACGAGCTGCTCACTGTGATA GGCAAAGGATTTGAGGACCTGATGACTGTGAATCTAGCAAGGTACAAACCAACAGGAGAGTACGTGACT GTACGGAGGATTAACCTAGAAGCTTGTTCCAATGAGATGGTAACATTCTTGCAGGGCGAGCTGCATGTC TCCAAACTCTTCAACCATCCCAATATCGTGCCATATCGAGCCACTTTTATTGCAGACAATGAGCTGTGG GTTGTCACATCATTCATGGCATACGGTTCTGCAAAAGATCTCATCTGTACACACTTCATGGATGGCATG AATGAGCTGGCGATTGCTTACATCCTGCAGGGGGTGCTGAAGGCCCTCGACTACATCCACCACATGGGA TATGTACACAGGAGTGTCAAAGCCAGCCACATCCTGATCTCTGTGGATGGGAAGGTCTACCTGTCTGGT TTGCGCAGCAACCTCAGCATGATAAGCCATGGGCAGCGGCAGCGAGTGGTCCACGATTTTCCCAAGTAC AGTGTCAAGGTTCTGCCGTGGCTCAGCCCCGAGGTCCTCCAGCAGAATCTCCAGGGTTATGATGCCAAG TCTGACATCTACAGTGTGGGAATCACAGCCTGTGAACTGGCCAACGGCCATGTCCCCTTTAAGGATATG CCTGCCACCCAGATGCTGCTAGAGAAACTGAACGGCACAGTGCCCTGCCTGTTGGATACCAGCACCATC CCCGCTGAGGAGCTGACCATGAGCCCTTCGCGCTCAGTGGCCAACTCTGGCCTGAGTGACAGCCTGACC ACCAGCACCCCCCGGCCCTCCAACGGCCCAGTGCCAGCACCCTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001165969 |
Insert Size | 945 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001165969.1 |
RefSeq Size | 2189 bp |
RefSeq ORF | 945 bp |
Locus ID | 92335 |
UniProt ID | Q7RTN6 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | mTOR signaling pathway |
MW | 34.6 kDa |
Gene Summary | The protein encoded by this gene contains a STE20-like kinase domain, but lacks several residues that are critical for catalytic activity, so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11, also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39, also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios, megalencephaly, and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (5) lacks two alternate in-frame exons in the 5' coding region and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The resulting isoform (5) lacks two internal segments, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228248 | STRADA (Myc-DDK-tagged)-Human STE20-related kinase adaptor alpha (STRADA), transcript variant 5 |
CNY 2400.00 |
|
RC228248L3 | Lenti-ORF clone of STRADA (Myc-DDK-tagged)-Human STE20-related kinase adaptor alpha (STRADA), transcript variant 5 |
CNY 5890.00 |
|
RC228248L4 | Lenti-ORF clone of STRADA (mGFP-tagged)-Human STE20-related kinase adaptor alpha (STRADA), transcript variant 5 |
CNY 5890.00 |
|
RG228248 | STRADA (tGFP-tagged) - Human STE20-related kinase adaptor alpha (STRADA), transcript variant 5 |
CNY 4370.00 |