AVPR V2 (AVPR2) (NM_001146151) Human Untagged Clone
CAT#: SC326877
AVPR2 (untagged)-Human arginine vasopressin receptor 2 (AVPR2) transcript variant 2
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ADHR; DI1; DIR; DIR3; NDI; NDI1; V2R |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001146151, the custom clone sequence may differ by one or more nucleotides
ATGCTCATGGCGTCCACCACTTCCGCTGTGCCTGGGCATCCCTCTCTGCCCAGCCTGCCC AGCAACAGCAGCCAGGAGAGGCCACTGGACACCCGGGACCCGCTGCTAGCCCGGGCGGAG CTGGCGCTGCTCTCCATAGTCTTTGTGGCTGTGGCCCTGAGCAATGGCCTGGTGCTGGCG GCCCTAGCTCGGCGGGGCCGGCGGGGCCACTGGGCACCCATACACGTCTTCATTGGCCAC TTGTGCCTGGCCGACCTGGCCGTGGCTCTGTTCCAAGTGCTGCCCCAGCTGGCCTGGAAG GCCACCGACCGCTTCCGTGGGCCAGATGCCCTGTGTCGGGCCGTGAAGTATCTGCAGATG GTGGGCATGTATGCCTCCTCCTACATGATCCTGGCCATGACGCTGGACCGCCACCGTGCC ATCTGCCGTCCCATGCTGGCGTACCGCCATGGAAGTGGGGCTCACTGGAACCGGCCGGTG CTAGTGGCTTGGGCCTTCTCGCTCCTTCTCAGCCTGCCCCAGCTCTTCATCTTCGCCCAG CGCAACGTGGAAGGTGGCAGCGGGGTCACTGACTGCTGGGCCTGCTTTGCGGAGCCCTGG GGCCGTCGCACCTATGTCACCTGGATTGCCCTGATGGTGTTCGTGGCACCTACCCTGGGT ATCGCCGCCTGCCAGGTGCTCATCTTCCGGGAGATTCATGCCAGTCTGGTGCCAGGGCCA TCAGAGAGGCCTGGGGGGCGCCGCAGGGGACGCCGGACAGGCAGCCCCGGTGAGGGAGCC CACGTGTCAGCAGCTGTGGCCAAGACTGTGAGGATGACGCTAGTGATTGTGGTCGTCTAT GTGCTGTGCTGGGCACCCTTCTTCCTGGTGCAGCTGTGGGCCGCGTGGGACCCGGAGGCA CCTCTGGAAGGTGGGTGTAGCCGTGGC |
Restriction Sites | Please inquire |
ACCN | NM_001146151 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001146151.1, NP_001139623.1 |
RefSeq Size | 1788 bp |
RefSeq ORF | 930 bp |
Locus ID | 554 |
UniProt ID | P30518 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | This gene encodes the vasopressin receptor, type 2, also known as the V2 receptor, which belongs to the seven-transmembrane-domain G protein-coupled receptor (GPCR) superfamily, and couples to Gs thus stimulating adenylate cyclase. The subfamily that includes the V2 receptor, the V1a and V1b vasopressin receptors, the oxytocin receptor, and isotocin and mesotocin receptors in non-mammals, is well conserved, though several members signal via other G proteins. All bind similar cyclic nonapeptide hormones. The V2 receptor is expressed in the kidney tubule, predominantly in the distal convoluted tubule and collecting ducts, where its primary property is to respond to the pituitary hormone arginine vasopressin (AVP) by stimulating mechanisms that concentrate the urine and maintain water homeostasis in the organism. When the function of this gene is lost, the disease Nephrogenic Diabetes Insipidus (NDI) results. The V2 receptor is also expressed outside the kidney although its tissue localization is uncertain. When these 'extrarenal receptors' are stimulated by infusion of a V2 selective agonist (dDAVP), a variety of clotting factors are released into the bloodstream. The physiologic importance of this property is not known - its absence does not appear to be detrimental in NDI patients. The gene expression has also been described in fetal lung tissue and lung cancer associated with alternative splicing. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has an additional segment in the CDS, as compared to variant 1. The resulting isoform (2) has shorter and different C-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228242 | AVPR2 (Myc-DDK-tagged)-Human arginine vasopressin receptor 2 (AVPR2), transcript variant 2 |
CNY 3600.00 |
|
RC228242L3 | Lenti-ORF clone of AVPR2 (Myc-DDK-tagged)-Human arginine vasopressin receptor 2 (AVPR2), transcript variant 2 |
CNY 5890.00 |
|
RC228242L4 | Lenti-ORF clone of AVPR2 (mGFP-tagged)-Human arginine vasopressin receptor 2 (AVPR2), transcript variant 2 |
CNY 5890.00 |
|
RG228242 | AVPR2 (tGFP-tagged) - Human arginine vasopressin receptor 2 (AVPR2), transcript variant 2 |
CNY 5200.00 |
其它AVPR V2产品