LEF1 (NM_001166119) Human Untagged Clone
CAT#: SC326872
LEF1 (untagged)-Human lymphoid enhancer-binding factor 1 (LEF1) transcript variant 4
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LEF-1; TCF1ALPHA; TCF7L3; TCF10 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001166119, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAGGTGGCCAGACAAGCACAAACCTCTCAGGAGCCCTACCACGACAAGGCCAGA GAACACCCCGATGACGGAAAGCATCCAGATGGAGGCCTCTACAACAAGGGACCCTCCTAC TCGAGTTATTCCGGGTACATAATGATGCCAAATATGAATAACGACCCATACATGTCAAAT GGATCTCTTTCTCCACCCATCCCGAGAACATCAAATAAAGTGCCCGTGGTGCAGCCATCC CATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGTGACGAGCACTTTTCTCCAGGA TCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATGTCCAGACATCCT CCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTGTTGGACAGATCACC CCACCTCTTGGCTGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACT GGCATCCCTCATCCAGCTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGAC AGTGACCTAATGCACGTGAAGCCTCAGCATGAACAGAGAAAGGAGCAGGAGCCAAAAAGA CCTCACATTAAGAAGCCTCTGAATGCTTTTATGTTATACATGAAAGAAATGAGAGCGAAT GTCGTTGCTGAGTGTACTCTAAAAGAAAGTGCAGCTATCAACCAGATTCTTGGCAGAAGG TGGCATGCCCTCTCCCGTGAAGAGCAGGCTAAATATTATGAATTAGCACGGAAAGAAAGA CAGCTACATATGCAGCTTTATCCAGGCTGGTCTGCAAGAGACAATTATGGTAAGAAAAAG AAGAGGAAGAGAGAGAAACTACAGGAATCTGCATCAGGTACAGGTCCAAGAATGACAGCT GCCTACATC |
Restriction Sites | Please inquire |
ACCN | NM_001166119 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001166119.1, NP_001159591.1 |
RefSeq Size | 2660 bp |
RefSeq ORF | 912 bp |
Locus ID | 51176 |
UniProt ID | Q9UJU2 |
Protein Families | Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Protein Pathways | Acute myeloid leukemia, Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Melanogenesis, Pathways in cancer, Prostate cancer, Thyroid cancer, Wnt signaling pathway |
Gene Summary | This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, and lacks an alternate in-frame exon in the central coding region, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228237 | LEF1 (Myc-DDK-tagged)-Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 4 |
CNY 3,600.00 |
|
RC228237L3 | Lenti-ORF clone of LEF1 (Myc-DDK-tagged)-Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 4 |
CNY 5,890.00 |
|
RC228237L4 | Lenti-ORF clone of LEF1 (mGFP-tagged)-Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 4 |
CNY 5,890.00 |
|
RG228237 | LEF1 (tGFP-tagged) - Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 4 |
CNY 5,200.00 |