Collagen XI alpha 2 (COL11A2) (NM_001163771) Human Untagged Clone
CAT#: SC326861
COL11A2 (untagged)-Human collagen type XI alpha 2 (COL11A2) transcript variant 4
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DFNA13; DFNB53; FBCG2; HKE5; OSMEDA; OSMEDB; PARP; STL3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326861 representing NM_001163771.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGCGGTGCAGCCGCTGCCATCGCCTCCTCCTCCTCCTACCTCTGGTGCTGGGGCTGAGCGCGGCC CCAGGCTGGGCAGGTGCACCCCCTGTGGATGTGCTCCGGGCCCTGAGGTTCCCCTCCCTCCCTGATGGT GTCCGGAGAGCGAAAGGCATCTGTCCAGCTGATGTGGCCTACCGAGTGGCACGACCTGCCCAGCTCAGT GCACCCACTCGCCAGCTTTTCCCAGGAGGATTTCCCAAAGATTTCTCTCTGCTGACTGTTGTCCGGACC CGCCCTGGTCTCCAAGCTCCCCTCCTGACTCTCTACAGTGCCCAGGGTGTCCGACAGCTGGGCCTGGAG CTGGGCCGACCTGTCCGCTTCCTGTATGAAGACCAGACTGGGCGGCCTCAACCTCCCTCTCAGCCAGTC TTCCGAGGCCTCAGCCTAGCAGATGGCAAGTGGCACCGTGTGGCTGTGGCTGTGAAGGGCCAGTCTGTC ACCCTCATTGTTGACTGCAAGAAGCGAGTCACCCGGCCTCTCCCCCGAAGTGCTCGTCCAGTATTGGAC ACCCATGGAGTGATCATCTTTGGTGCCCGTATTCTGGATGAAGAAGTCTTTGAGGGTGATGTCCAGGAG CTGGCCATTGTCCCAGGGGTCCAGGCAGCCTATGAATCATGTGAACAGAAGGAGCTGGAATGCGAGGGG GGCCAGAGGGAAAGACCCCAAAACCAACAGCCTCACAGAGCCCAGAGATCTCCACAGCAGCAACCATCA AGACTTCACAGGCCACAAAATCAGGAACCCCAGAGCCAGGTGAGGGAGCTGGGAGAACCCCCAAGTGCA GCACACCCCAGAGAGGGAAGACACCCAGGCATCTCTCCTCCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001163771 |
| Insert Size | 873 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001163771.1 |
| RefSeq Size | 1237 bp |
| RefSeq ORF | 873 bp |
| Locus ID | 1302 |
| UniProt ID | P13942 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | ECM-receptor interaction, Focal adhesion |
| MW | 32 kDa |
| Gene Summary | This gene encodes one of the two alpha chains of type XI collagen, a minor fibrillar collagen. It is located on chromosome 6 very close to but separate from the gene for retinoid X receptor beta. Type XI collagen is a heterotrimer but the third alpha chain is a post-translationally modified alpha 1 type II chain. Proteolytic processing of this type XI chain produces PARP, a proline/arginine-rich protein that is an amino terminal domain. Mutations in this gene are associated with type III Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED syndrome), Weissenbacher-Zweymuller syndrome, autosomal dominant non-syndromic sensorineural type 13 deafness (DFNA13), and autosomal recessive non-syndromic sensorineural type 53 deafness (DFNB53). Alternative splicing results in multiple transcript variants. A related pseudogene is located nearby on chromosome 6. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (4) lacks several exons at the 3' end and has a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is considerably shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228226 | COL11A2 (Myc-DDK-tagged)-Human collagen, type XI, alpha 2 (COL11A2), transcript variant 4 |
CNY 2400.00 |
|
| RC228226L3 | Lenti ORF clone of Human collagen, type XI, alpha 2 (COL11A2), transcript variant 4, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC228226L4 | Lenti ORF clone of Human collagen, type XI, alpha 2 (COL11A2), transcript variant 4, mGFP tagged |
CNY 5890.00 |
|
| RG228226 | COL11A2 (tGFP-tagged) - Human collagen, type XI, alpha 2 (COL11A2), transcript variant 4 |
CNY 4370.00 |
其它Collagen XI alpha 2产品
