PDHX (NM_001166158) Human Untagged Clone

CAT#: SC326840

PDHX (untagged)-Human pyruvate dehydrogenase complex component X (PDHX) nuclear gene encoding mitochondrial protein transcript variant 3



  "NM_001166158" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Antibody against PDHX (T11)
    • 400 ul

CNY 6160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DLDBP; E3BP; OPDX; PDHXD; PDX1; proX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326840 representing NM_001166158.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCCTCCTGGAGGCTGGGCTGTGATCCGCGGCTGCTGCGTTATCTTGTGGGCTTCCCCGGCCGC
CGAAGCGTAGGGCTGGTGAAGGGGGCTCTTGGGTGGTCTGTAAGCCGCGGAGCTAATTGGAGATGGTTT
CACAGCACGCAGTGGCTTCGGGGTGATCCCATTAAGATACTAATGCCATCACTGTCTCCTACAATGGAA
GAAGGAAACATTGTGAAATGGCTGAAAAAGGAAGGTGAAGCGGTGAGTGCTGGAGATGCATTATGTGAA
ATTGAGACTGACAAAGCTGTGGTTACCTTAGATGCAAGTGATGATGGAATCTTGGCCAAAATCGTGCAA
ATGCCAGATGTTAATGTAAGCTGGGATGGAGAGGGCCCAAAGCAACTGCCATTTATTGACATTTCAGTG
GCTGTGGCAACAGATAAAGGCTTACTTACTCCAATCATAAAAGATGCTGCTGCTAAAGGTATCCAGGAA
ATTGCTGACTCTGTAAAGGCTCTATCAAAGAAAGCAAGAGATGGAAAATTGTTGCCTGAAGAATACCAA
GGAGGATCTTTTAGTATTTCCAACTTGGGGATGTTTGGCATCGACGAATTTACTGCAGTGATTAACCCT
CCTCAGGCCTGCATTTTGGCGGTTGGGAGGTTCCGACCTGTGCTGAAGCTCACTGAGGATGAAGAGGGA
AATGCCAAACTGCAGCAGCGCCAGCTCATAACAGTCACAATGTCAAGTGACAGTCGAGTGGTTGATGAC
GAACTGGCAACCAGGTTTCTTAAAAGTTTTAAAGCAAACCTAGAGAATCCTATCCGACTTGCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166158
Insert Size 825 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166158.1
RefSeq Size 2310 bp
RefSeq ORF 825 bp
Locus ID 8050
UniProt ID O00330
MW 29.9 kDa
Gene Summary The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Transcript Variant: This variant (3) lacks multiple in-frame exons in the central coding region, compared to variant 1, resulting in a protein (isoform 3) that lacks 227 aa, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...