STPG4 (NM_001163561) Human Untagged Clone
CAT#: SC326813
C2orf61 (untagged)-Human chromosome 2 open reading frame 61 (C2orf61) transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C2orf61; GSE |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326813 representing NM_001163561.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACCAGCCAGCCGTCGCCACCGCTTCCACCTCAATAAGGGAAGACCTGGTGGGTGGAGAATCATTC ATCACAGCTTCGAAACCAGCCCAAAAGACTTCCTCTTTTGAAAGAGAAGGATGGTGGAGAATAGCATTA ACAGATACTCCTATACCTGGCACTTACCACTTGAAAACTTTTATTGAAGAATCCCTATTAAATCCAGTG ATAGCAACCTACAATTTTAAAAACGAAGGAAGGAAAAAGCCACCTCTTGTGCAAAGAAACAATCCAGTC CTAAATGATCTTCCGCAGTATATGCCTCCTGACTTCCTGGACCTGTTAAAGAAGCAAGTGGCTACTTAC TCATTCAAAGACAAACCACGGCCAAGCCCCAGCACACTAGTTGACAAAGATCAGTCACTTCAGCTTTCT CCGGGGCAATACAACGTGCTTCCTGCACCAGTTCCCAAATATGCTTCCAGGAGCTGTGTATTTCGCTCA ACAGTTCAAAGATTCCCAACAACCTATTTTATTCCCCATGAAGGCCCTGGTCCAGGTCATTATAATGTG AAAATGCCTCCAACAAGCTCTGTCACTTCTTGTTTTCAATCCAGAGTCCCTCGATTCTTGCCCAGCTGT TCAAAAACCCCAGGCCCAGGAGCATATACAACTTTAAGACAATTCCCTAAGCAGTCTCCGACCATAGCC AAAATGGGCCAAGAGCATAGCCTTTTCTTCAACAACAACAATTGGCTTTTAAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001163561 |
| Insert Size | 747 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001163561.1 |
| RefSeq Size | 891 bp |
| RefSeq ORF | 747 bp |
| Locus ID | 285051 |
| UniProt ID | Q8N801 |
| MW | 27.8 kDa |
| Gene Summary | Maternal factor that plays a role in epigenetic chromatin reprogramming during early development of the zygote. Involved in the regulation of gametic DNA demethylation by inducing the conversion of the modified genomic base 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228178 | C2orf61 (Myc-DDK-tagged)-Human chromosome 2 open reading frame 61 (C2orf61), transcript variant 1 |
CNY 3600.00 |
|
| RC228178L3 | Lenti ORF clone of Human chromosome 2 open reading frame 61 (C2orf61), transcript variant 1, Myc-DDK-tagged |
CNY 6000.00 |
|
| RC228178L4 | Lenti ORF clone of Human chromosome 2 open reading frame 61 (C2orf61), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG228178 | C2orf61 (tGFP-tagged) - Human chromosome 2 open reading frame 61 (C2orf61), transcript variant 1 |
CNY 4370.00 |
