KLF6 (NM_001160124) Human Untagged Clone

CAT#: SC326809

KLF6 (untagged)-Human Kruppel-like factor 6 (KLF6) transcript variant B



  "NM_001160124" in other vectors (4)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
Rabbit polyclonal KLF6 Antibody (C-term)
    • 400 ul

CNY 6314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BCD1; CBA1; COPEB; CPBP; GBF; PAC1; ST12; ZF9
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001160124, the custom clone sequence may differ by one or more nucleotides


ATGGACGTGCTCCCCATGTGCAGCATCTTCCAGGAGCTCCAGATCGTGCACGAGACCGGCTACTTCTCGG
CGCTGCCGTCTCTGGAGGAGTACTGGCAACAGACCTGCCTAGAGCTGGAACGTTACCTCCAGAGCGAGCC
CTGCTATGTTTCAGCCTCAGAAATCAAATTTGACAGCCAGGAAGATCTGTGGACCAAAATCATTCTGGCT
CGGGAGAAAAAGGAGGAATCCGAACTGAAGATATCTTCCAGTCCTCCAGAGGACACTCTCATCAGCCCGA
GCTTTTGTTACAACTTAGAGACCAACAGCCTGAACTCAGATGTCAGCAGCGAATCCTCTGACAGCTCCGA
GGAACTTTCTCCCACGGCCAAGTTTACCTCCGACCCCATTGGCGAAGTTTTGGTCAGCTCGGGAAAATTG
AGCTCCTCTGTCACCTCCACGCCTCCATCTTCTCCGGAACTGAGCAGGGAACCTTCTCAACTGTGGGGTT
GCGTGCCCGGGGAGCTGCCCTCGCCAGGGAAGGTGCGCAGCGGGACTTCGGGGAAGCCAGGAGAAAAGCC
TTACAGATGCTCATGGGAAGGGTGTGAGTGGCGTTTTGCAAGAAGTGATGAGTTAACCAGGCACTTCCGA
AAGCACACCGGGGCCAAGCCTTTTAAATGCTCCCACTGTGACAGGTGTTTTTCCAGGTCTGACCACCTGG
CCCTGCACATGAAGAGGCACCTCTGA


Restriction Sites Please inquire     
ACCN NM_001160124
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001160124.1, NP_001153596.1
RefSeq Size 4553 bp
RefSeq ORF 726 bp
Locus ID 1316
UniProt ID Q99612
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Gene Summary This gene encodes a member of the Kruppel-like family of transcription factors. The zinc finger protein is a transcriptional activator, and functions as a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene, some of which are implicated in carcinogenesis. [provided by RefSeq, May 2009]
Transcript Variant: This variant (B), also known as sv2, uses an alternate splice site in the central coding region that results in a frameshift, compared to variant A. The resulting isoform (B) has a shorter and distinct C-terminus, compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...