RAB2B (NM_001163380) Human Untagged Clone
CAT#: SC326742
RAB2B (untagged)-Human RAB2B member RAS oncogene family (RAB2B) transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326742 representing NM_001163380.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTCAACATTGATGGAAAACAAATCAAACTGCAAATCTGGGATACGGCTGGGCAAGAATCCTTCCGT TCTATCACCCGTTCCTACTACAGGGGAGCAGCTGGAGCACTGCTGGTGTACGACATTACAAGGCGTGAA ACCTTCAACCACCTGACCTCATGGTTAGAGGATGCCCGGCAGCACTCTAGTTCCAACATGGTTATCATG CTCATTGGGAATAAGAGTGACCTAGAGTCCCGCAGGGATGTGAAGAGAGAAGAAGGAGAGGCCTTTGCT AGGGAGCATGGACTTATATTCATGGAAACTTCAGCCAAAACAGCCTGCAATGTTGAAGAGGCCTTCATT AACACAGCCAAAGAAATATATAGGAAGATCCAGCAGGGTTTATTTGATGTCCACAATGAGGCAAATGGC ATCAAGATTGGGCCCCAACAGTCAATTTCAACATCAGTGGGACCCAGTGCCTCCCAGCGGAACTCTCGT GACATAGGGTCCAACTCTGGCTGCTGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001163380 |
| Insert Size | 513 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001163380.1 |
| RefSeq Size | 2883 bp |
| RefSeq ORF | 513 bp |
| Locus ID | 84932 |
| UniProt ID | Q8WUD1 |
| Protein Families | Druggable Genome |
| MW | 19 kDa |
| Gene Summary | Members of the Rab protein family are nontransforming monomeric GTP-binding proteins of the Ras superfamily that contain 4 highly conserved regions involved in GTP binding and hydrolysis. Rab proteins are prenylated, membrane-bound proteins involved in vesicular fusion and trafficking; see MIM 179508.[supplied by OMIM, Apr 2006] Transcript Variant: This variant (2) represents use of an alternate promoter and 5' UTR and uses a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228107 | RAB2B (Myc-DDK-tagged)-Human RAB2B, member RAS oncogene family (RAB2B), transcript variant 2 |
CNY 2400.00 |
|
| RC228107L3 | Lenti ORF clone of Human RAB2B, member RAS oncogene family (RAB2B), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC228107L4 | Lenti ORF clone of Human RAB2B, member RAS oncogene family (RAB2B), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG228107 | RAB2B (tGFP-tagged) - Human RAB2B, member RAS oncogene family (RAB2B), transcript variant 2 |
CNY 4370.00 |
