ABCB5 (NM_001163942) Human Untagged Clone
CAT#: SC326706
ABCB5 (untagged)-Human ATP-binding cassette sub-family B (MDR/TAP) member 5 (ABCB5) transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ABCB5alpha; ABCB5beta; EST422562 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326706 representing NM_001163942.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGGATGAGAATGACATCAGAGCTTTAAATGTGCGGCATTATCGAGACCATATTGGAGTGGTTAGT CAAGAGCCTGTTTTGTTCGGGACCACCATCAGTAACAATATCAAGTATGGACGAGATGATGTGACTGAT GAAGAGATGGAGAGAGCAGCAAGGGAAGCAAATGCGTATGATTTTATCATGGAGTTTCCTAATAAATTT AATACATTGGTAGGGGAAAAAGGAGCTCAAATGAGTGGAGGGCAGAAACAGAGGATCGCAATTGCTCGT GCCTTAGTTCGAAACCCCAAGATTCTGATTTTAGATGAGGCTACGTCTGCCCTGGATTCAGAAAGCAAG TCAGCTGTTCAAGCTGCACTGGAGAAGGATACCCCCAGGTATTCATTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163942 |
Insert Size | 396 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001163942.1 |
RefSeq Size | 2247 bp |
RefSeq ORF | 396 bp |
Locus ID | 340273 |
UniProt ID | Q2M3G0 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | ABC transporters |
MW | 14.7 kDa |
Gene Summary | ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (3) differs in the 5' and 3' UTRs and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (3) with a shorter N-terminus and a shorter and distinct C-terminus, compared to variant 1. This variant (3) is the mRNA isoform alpha as described in PMID 15760339. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228071 | ABCB5 (Myc-DDK-tagged)-Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5), transcript variant 3 |
CNY 1200.00 |
|
RC228071L3 | Lenti-ORF clone of ABCB5 (Myc-DDK-tagged)-Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5), transcript variant 3 |
CNY 5890.00 |
|
RC228071L4 | Lenti-ORF clone of ABCB5 (mGFP-tagged)-Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5), transcript variant 3 |
CNY 5890.00 |
|
RG228071 | ABCB5 (tGFP-tagged) - Human ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5), transcript variant 3 |
CNY 4370.00 |