Inositol Hexakisphosphate Kinase 2 (IP6K2) (NM_001146178) Human Untagged Clone

CAT#: SC326666

IP6K2 (untagged)-Human inositol hexakisphosphate kinase 2 (IP6K2) transcript variant 5



  "NM_001146178" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
IP6K2 mouse monoclonal antibody,clone OTI1F12
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IHPK2; InsP6K2; PIUS
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001146178, the custom clone sequence may differ by one or more nucleotides
ATGAGCCCAGCCTTCAGGGCCATGGATGTGGAGCCCCGCGCCAAAGGCGTCCTTCTGGAG
CCCTTTGTCCACCAGGTCGGGGGGCACTCATGCGTGCTCCGCTTCAATGAGACAACCCTG
TGCAAGCCCCTGGTCCCAAGGGAACATCAGTTCTACGAGACCCTCCCTGCTGAGATGCGC
AAATTCACTCCCCAGTACAAAGGGGACATCAGCAGCCACCAGCATGGTGGGGTCTTTGTT
GGGGAGTGGGGGAGTCTTTTG
Restriction Sites Please inquire     
ACCN NM_001146178
Insert Size 1324 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001146178.1, NP_001139650.1
RefSeq Size 1324 bp
RefSeq ORF 264 bp
Locus ID 51447
UniProt ID Q9UHH9
Protein Families Druggable Genome
Gene Summary This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus compared to isoform a. Variants 5 and 6 encode the same isoform (c).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Inositol Hexakisphosphate Kinase 2产品

Customer Reviews 
Loading...