Small integral membrane protein 1 (SMIM1) (NM_001163724) Human Untagged Clone
CAT＃: SC326662
SMIM1 (untagged)-Human hypothetical protein LOC388588 (LOC388588)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Vel |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC326662 representing NM_001163724.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGCCCCAGGAGAGCCACGTCCACTATAGTAGGTGGGAGGACGGCAGCAGGGACGGAGTCAGCCTA GGGGCTGTGTCCAGCACAGAAGAGGCCTCACGCTGCCGCAGGATCTCCCAGAGGCTGTGCACGGGCAAG CTGGGCATCGCCATGAAGGTGCTGGGCGGCGTGGCCCTCTTCTGGATCATCTTCATCCTGGGCTACCTC ACAGGCTACTATGTGCACAAGTGCAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001163724 |
| Insert Size | 237 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001163724.2 |
| RefSeq Size | 556 bp |
| RefSeq ORF | 237 bp |
| Locus ID | 388588 |
| UniProt ID | B2RUZ4 |
| MW | 8.7 kDa |
| Gene Summary | This gene encodes a small, conserved protein that participates in red blood cell formation. The encoded protein is localized to the cell membrane and is the antigen for the Vel blood group. Alternative splicing results in different transcript variants that encode the same protein. [provided by RefSeq, Dec 2013] Transcript Variant: This variant (1) encodes the longer transcript. Both variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228027 | SMIM1 (Myc-DDK-tagged)-Human hypothetical protein LOC388588 (LOC388588) |
CNY 1800.00 |
|
| RC228027L1 | Lenti ORF clone of Human hypothetical protein LOC388588 (LOC388588), Myc-DDK-tagged |
CNY 4200.00 |
|
| RC228027L2 | Lenti ORF clone of Human hypothetical protein LOC388588 (LOC388588), mGFP tagged |
CNY 5890.00 |
|
| RC228027L3 | Lenti ORF clone of Human hypothetical protein LOC388588 (LOC388588), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC228027L4 | Lenti ORF clone of Human hypothetical protein LOC388588 (LOC388588), mGFP tagged |
CNY 5890.00 |
|
| RG228027 | SMIM1 (tGFP-tagged) - Human hypothetical protein LOC388588 (LOC388588) |
CNY 3400.00 |
其它Small integral membrane protein 1产品
