MYEOV2 (COPS9) (NM_001163424) Human Untagged Clone

CAT#: SC326656

MYEOV2 (untagged)-Human myeloma overexpressed 2 (MYEOV2) transcript variant 2



  "NM_001163424" in other vectors (6)

CNY 1920.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CSNAP; MYEOV2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001163424, the custom clone sequence may differ by one or more nucleotides
ATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGCCGGGCCCTACGTGGACCTGGAC
GAGGCGGGAGGCAGCACCGGGCTCTTGATGGACTTGGCAGCCAATGAAAAGGCCGTTCAT
GCAGACTTTTTTAACGATTTTGAAGATCTTTTTGATGATGATGACATCCAG
Restriction Sites Please inquire     
ACCN NM_001163424
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001163424.1, NP_001156896.1
RefSeq Size 456 bp
RefSeq ORF 174 bp
Locus ID 150678
UniProt ID Q8WXC6
Gene Summary Isoform 1: Component of the COP9 signalosome complex (CSN), a complex involved in various cellular and developmental processes. The CSN complex is an essential regulator of the ubiquitin (Ubl) conjugation pathway by mediating the deneddylation of the cullin subunits of SCF-type E3 ligase complexes, leading to decrease the Ubl ligase activity of SCF-type complexes such as SCF, CSA or DDB2. The complex is also involved in phosphorylation of p53/TP53, c-jun/JUN, IkappaBalpha/NFKBIA, ITPK1 and IRF8/ICSBP, possibly via its association with CK2 and PKD kinases. CSN-dependent phosphorylation of TP53 and JUN promotes and protects degradation by the Ubl system, respectively. Plays a role in cell proliferation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region and an alternate splice pattern in the 3' coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment near the N-terminus and has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...