GPSM1 (NM_001145639) Human Untagged Clone
CAT#: SC326531
GPSM1 (untagged)-Human G-protein signaling modulator 1 (AGS3-like, C. elegans) (GPSM1), transcript variant 3, mRNA
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AGS3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001145639, the custom clone sequence may differ by one or more nucleotides
ATGGACGACCAGCGTTGTCCCCTGGACGATGGCCAGGCCGGGGCTGCCGAGGCCACGGCC GCCCCCACCCTGGAGGACAGGATCGCCCAGCCCTCGATGACGGCCTCGCCCCAGACCGAG GAATTCTTCGACCTCATCGCCAGCTCCCAGAGCCGCCGGCTGGACGACCAGCGGGCCAGC GTGGGCAGCCTGCCGGGGCTGCGAATCACCCACAGCAATGCAGGGCACCTCCGAGGCCAC GGCGAGCCCCAGGAGCCGGGGGACGACTTCTTCAACATGCTCATCAAGTACCAGTCCTCC AGGATCGATGACCAGCGCTGCCCGCCACCTGACGTACTGCCCCGGGGCCCTACCATGCCG GACGAGGACTTCTTCAGCCTCATTCAGAGGGTGCAGGCTAAGCGCATGGACGAGCAGCGG GTGGACCTCGCCGGGGGCCCGGAGCAGGGGGCAGGCGGCCCGCCCGAGCCCCAGCAGCAG TGCCAGCCTGGTGCGAGC |
| Restriction Sites | Please inquire |
| ACCN | NM_001145639 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145639.1, NP_001139111.1 |
| RefSeq Size | 2075 bp |
| RefSeq ORF | 501 bp |
| Locus ID | 26086 |
| UniProt ID | Q86YR5 |
| Gene Summary | G-protein signaling modulators (GPSMs) play diverse functional roles through their interaction with G-protein subunits. This gene encodes a receptor-independent activator of G protein signaling, which is one of several factors that influence the basal activity of G-protein signaling systems. The protein contains seven tetratricopeptide repeats in its N-terminal half and four G-protein regulatory (GPR) motifs in its C-terminal half. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (3) differs in the 5' UTR, lacks multiple 5' coding exons, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c, also known as AGS3-SHORT) is shorter at the N-terminus, compared to isoform a. Both variants 3 and 4 encode the same isoform (c). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227685 | GPSM1 (Myc-DDK-tagged)-Human G-protein signaling modulator 1 (GPSM1), transcript variant 3 |
CNY 3990.00 |
|
| RC227685L3 | Lenti-ORF clone of GPSM1 (Myc-DDK-tagged)-Human G-protein signaling modulator 1 (GPSM1), transcript variant 3 |
CNY 5890.00 |
|
| RC227685L4 | Lenti-ORF clone of GPSM1 (mGFP-tagged)-Human G-protein signaling modulator 1 (GPSM1), transcript variant 3 |
CNY 5890.00 |
|
| RG227685 | GPSM1 (tGFP-tagged) - Human G-protein signaling modulator 1 (GPSM1), transcript variant 3 |
CNY 4370.00 |
