GALP (NM_001145546) Human Untagged Clone
CAT＃: SC326517
GALP (untagged)-Human galanin-like peptide (GALP), transcript variant 2, mRNA
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001145546, the custom clone sequence may differ by one or more nucleotides
ATGGCTCCTCCCTCCGTCCCCCTGGTCCTCCTCCTCGTCCTCTTGCTGAGCCTGGCAGAG ACTCCAGCATCCGCACCTGCCCACCGGTCCTCCACCTTCCCCAAATGGGTGACCAAGACG GAAAGAGGGAGACAGCCCTTGAGATCC |
| Restriction Sites | Please inquire |
| ACCN | NM_001145546 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145546.1, NP_001139018.1 |
| RefSeq Size | 889 bp |
| RefSeq ORF | 150 bp |
| Locus ID | 85569 |
| UniProt ID | Q9UBC7 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene encodes a member of the galanin family of neuropeptides. The encoded protein binds galanin receptors 1, 2 and 3 with the highest affinity for galanin receptor 3 and has been implicated in biological processes involving the central nervous system including hypothalamic regulation of metabolism and reproduction. A peptide encoded by a splice variant of this gene, termed alarin, has vasoactive properties, displays antimicrobial activity against E. coli, and may serve as a marker for neuroblastic tumors.[provided by RefSeq, Nov 2014] Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus compared to isoform 1. This variant, termed alarin, is a candidate for nonsense-mediated mRNA decay (NMD) but is being represented as protein-coding based on evidence supporting the transcript and protein described in PMID 16954604. The exon structure of this variant is based on Figure 1 from PMID 16954604. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227446 | GALP (Myc-DDK-tagged)-Human galanin-like peptide (GALP), transcript variant 2 |
CNY 3990.00 |
|
| RC227446L3 | Lenti-ORF clone of GALP (Myc-DDK-tagged)-Human galanin-like peptide (GALP), transcript variant 2 |
CNY 5890.00 |
|
| RC227446L4 | Lenti-ORF clone of GALP (mGFP-tagged)-Human galanin-like peptide (GALP), transcript variant 2 |
CNY 5890.00 |
|
| RG227446 | GALP (tGFP-tagged) - Human galanin-like peptide (GALP), transcript variant 2 |
CNY 4370.00 |
